Supporting Information

Transcription

1 Supporting Information Wiley-VCH Weinheim, Germany

2 Cell-free transcription/translation from PCR-amplified DNA for high-throughput NMR studies Peter S. C. Wu, Kiyoshi Ozawa, Siew Pheng Lim, Subhash G. Vasudevan, Nicholas E. Dixon, and Gottfried Otting Figure S1. 15 N-HSQC spectrum of τ C 14 produced by cell-free protein synthesis with 15 N-labeled Ala, Lys, Arg, Phe, Gln, Met, Cys and Trp. The DNA template used for transcription was generated in two PCR steps from the τ C 14 gene in a λ promoter vector (psj1308), [1] where the first step added the T7 φ10 promoter and T7 terminator to the ends of the τ C 14 gene. Based on pet vector sequences, [2] the following primers were designed. Forward primer: 5 -TCGATCCCGCGAAATTAATACGACTCACTATAGG GAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAAC (bold characters identify the sequence complementary to psj1308 upstream of the ribosome binding site. Red characters identify the stem loop structure. The T7 promoter sequence is marked by underlining. Blue identifies a 15 bp upstream sequence for improved transcription.); reverse primer: 5 -CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTT ATGTTACTGAATATTATTATC (Bold sequence complementary to τ C 14; underlined T7 terminator). The second PCR step was performed as illustrated in Figure 1. The spectrum shows the same cross-peaks as Figure S4, where the protein was prepared directly using a T7-promoter plasmid as template. The 15 N-labeled amino acids in this spectrum (Trp, Arg, Cys, Phe, Ala, Lys, Gln, Met) and in the spectra of Figures 4, S3 and S4 were provided at the concentrations reported in ref. 3. 1

3 Figure S2. Modified overlap extension protocol for generation of site-directed mutant templates suitable for direct expression in E. coli cell-free transcription/translation systems. Primers 1-4 are those reported in Figure 2. Only a single additional PCR step is required to generate a site-directed mutation. NMR spectra of the expressed mutants can be recorded in the cell-free reaction mixture without protein purification. Following PCR amplification, purification of the template can be achieved by use of the QiaQuick PCR purification kit (Qiagen). Purification after the first step determines the background of wild-type DNA. Using the purification kit, 5-15% wild-type protein was detected by NMR spectroscopy, whereas purification by agarose gel electrophoresis reduced the background of wild-type DNA to less than 2% (Figure S4). The conditions of the PCR were chosen as per the manufacturer s recommendation (New England Biolabs). The cycling parameters of the mutagenesis PCR were: 94 o C (2 min), 25 x [94 o C (40 s), 54 o C (40 s), 74 o C (60 s)], 74 o C (2 min). The cycling parameters of the template generating PCR were: 94 o C (2 min), 30 x [94 o C (40 s), 54 o C (40 s), 74 o C (60 s)], 74 o C (2 min). 2

4 Figure S3. 15 N-HSQC (left panel) and 13 C-HSQC spectra (right panel) of each of the 16 Ile Val mutants of the dengue virus NS2B/NS3 protease at ph 6.9 and 25 o C. Arrows identify the positions of cross-peaks which were substantially weaker due to mutation. a) 3

5 Figure S3, continued 4

6 Figure S3, continued 5

7 Figure S3 continued a ) The two most intense peaks in the 13 C-HSQC spectra contain the unresolved crosspeaks of C γ2 H 3 and C δ H 3 resonances of highly mobile Ile residues. 6

8 Figure S4. Superposition of three 15 N-HSQC spectra of mutant and wild-type τ C 14 prepared by cell-free protein synthesis from PCR templates. The protein samples were prepared with 15 N-labeled Ala, Lys, Arg, Phe, Gln, Met, Cys and Trp. Ala54 was mutated to Cys. The superposition illustrates the amount of residual wild-type protein following site-directed mutagenesis by overlap extension to generate the PCR products. Yellow wild type protein; green mutagenesis without gel-purification at PCR cleanup step 1 (Figure S1); red mutagenesis with gel-purification of PCR products at PCR cleanup step 1. The top-left panels show the spectra plotted individually, illustrating the change from the Ala54 cross-peak in the wild-type protein to the Cys54 cross-peak in the mutants. The spectra of the mutants were plotted at a lower level to show any wild-type contamination. 7

9 Figure S5. 15 N-HSQC spectrum of uniformly 15 N/ 13 C labeled dengue virus NS2B/NS3 protease recorded at ph 7.1 and 25 o C, using the same spectrometer and acquisition parameters as for the other NMR spectra. The rectangle identifies the spectral region selected in the left panel of Figure S3. 8

10 References: [1] S. Jergic, K. Ozawa, N. K. Williams, X.-C. Su, D. D. Scott, S. M. Hamdan, J. A. Crowther, G. Otting, N. E. Dixon, Nucl. Acids Res. 2007, in press [2] F. W. Studier, A. H. Rosenberg, J. J. Dunn, J. W. Dubendorff, Methods Enzymol. 1990, 185, [3] K. Ozawa, M. J. Headlam, P. M. Schaeffer, B. R. Henderson, N. E. Dixon, G. Otting, Eur. J. Biochem. 2004, 271,