Supporting Online Material for

Transcription

1 Supporting Online Material for HDAC4 Regulates Neuronal Survival in Normal and Diseased Retinas Bo Chen and Constance L. Cepko This PDF file includes: Materials and Methods Figs. S1 to S11 References Published 9 January 2009, Science 323, 256 (2009) DOI: /science

2 Materials and Methods Animals Wild type CD1 and retinal degeneration rd1 (FVB stain) mice were purchased from the Charles River Laboratory. RNAi and in vivo electroporation HDAC4 RNAi target sequence GGAGATGCTGGCCATGAAGCA was cloned into pbs/u6 RNAi construct (1). To produce the HDAC4 RNAi resistant expression vector, the shrna target sequence was mutated (mutated nucleotides in small letters) to GGAaATGCTaGCtATGAAaCA using degenerate codons. pcag-hdac4, pcag-hdac6, pcag-dnhif1α, pcag-hif1α, and pcag-hif1αk532r constructs were used for in vivo electroporations. HIF1α RNAi target sequences: GAGCTTGCTCATCAGTTGCCA and GGGTTGAAACTCAAGCAACTG. TUNEL assay, immunohistochemistry and fluorescence microscopy TUNEL assay and immunohistochemistry were performed as previously described (2). Fluorescence images of retinal sections were processed using the LEICA TCS SP2 confocal microscope. Fluorescence images of flat-mount retinas were processed using Nikon ECLIPSE E1000 microscope. Primary antibody used: HDAC4 (Sigma, 1:200), blocking peptide for HDAC4 MSSQSHPDGLSGRDQPVEL was used at 0.1 μg/μl; Rho4D2 for Rhodopsin ((3) 1:100); activated caspase3 (Cell Signaling, 1:200); HIF1α (Novus Biologicals, 1:300). Clonal analysis Clonal analysis using replication-incompetent retrovirus LIA was performed as previously described by injecting virus into the subretinal space of P0 CD1 mice (4, 5) and processing at P21.

3 Fig. S1 HDAC4 is mainly cytoplasmic in the developing mouse retina. P1 retinal sections were double-immunostained for HDAC4 (A) and Pax6 (B), overlay in (C).

4 Fig. S2 HDAC4 RNAi screen in transfected 293T cells. HDAC4 sensor HDAC4-IRES- GFP was co-transfected with either shrna to HDAC4 or shrna to GAPDH into 293T cells. HDAC4 sensor knockdown was assayed 24 hours after transfection. pcag-hcred was cotransfected to monitor the transfection efficiency. (A) HDAC4-IRES-GFP was knocked down by HDAC4 RNAi, not by GAPDH RNAi (B), while a comparable number of cells were transfected (C, D).

5 Fig. S3 Apoptosis caused by HDAC4 RNAi. RNAi vectors targeting GAPDH or HDAC4 were electroporated into the wild type mouse retina at P0, with assay at P5 (A-G). (A- C) TUNEL analysis for apoptotic cell death. (A) Cryosections from retinas with GAPDH RNAi. Arrows, TUNEL+ cells. (B) Cryosections from retinas with HDAC4 RNAi. Arrows, TUNEL+ but GFP- cells. Arrowheads, TUNEL+/GFP+cells. (C) Cryosections from retinas with HDAC4 RNAi, from the non-transfected area of HDAC4

6 electroporated retina. Arrows, TUNEL positive cells. (D-G) Activated caspase-3 immunohistochemistry. (D) GAPDH RNAi retinal sections. (E) HDAC4 RNAi sections. Arrows, activated caspase-3+/gfp+ cells. (F) Image in (D) without GFP overlay. (G) Image in (E) without GFP overlay. (H) The number of GFP+ cells following electroporation of HDAC4 shrna or GAPDH shrna was counted per 100 μm section from 3 electroporated retinas for each treatment at P3, P4, P5, and P6. The number of GFP+ cells observed in retinas with HDAC4 shrna was expressed as a percentage of the number of GFP+ cells in cells transfected by GAPDH shrna. Fig. S4 HDAC4 overexpression rescues BP cells from naturally occurring cell death. Cryosections from retinas electroporated by pcag-gfp (A) or pcag-hdac4 (B), with BP cells located in the upper half of the INL, and their processes extending to the IPL.

7 Fig. S5 Rescue of retinal degeneration by HDAC4, but not by HDAC6. (A-D) rd1 retinas were electroporated at P0 with pcag-gfp and pcag-hdac4 (B, D), or pcag- HDAC6 (A, C), and assayed at P50 for rod photoreceptor survival using anti-rhodopsin on flat-mount retinas (red). GFP marks area of electroporation (green).

8 Fig. S6 HDAC4, but not HDAC5, rescues retinal degeneration. (A-D) rd1 retinas were electroporated at P0 with pcag-gfp and pcag-hdac4 (B, D), or pcag-hdac5 (A, C), and assayed at P50 for rod photoreceptor survival using anti-rhodopsin on sections (red).

9 Fig. S7 HDAC6 overexpression rescues BP cells from naturally occurring cell death. P14 cryosections from wild type retinas electroporated at P0 by pcag-gfp (A) or pcag- HDAC6, with BP cells located in the upper half of the INL.

10 Fig. S8 Localization of HDAC4, electroporated in wild type retinas at P0, was examined at P14 in photoreceptors by confocal microscopy. The detected HDAC4 immunoreactivity (A) was excluded from DAPI-stained photoreceptor nuclei, and was preferentially localized outside LaminB-stained (B) nuclear envelope in the overlay (C). (D-F) HDAC4 immunoreactivity is sandwiched between two adjacent photoreceptor nuclei. Arrow heads, HDAC4 immunoreactivity. Arrows, LaminB immunoreactivity.

11 Fig. S9 Localization of HDAC4 cytoplasmic and nuclear mutants (HDAC4 L175A and HDAC4-3SA, respectively), electorporated in wild type retinas at P0, was examined at P14 in photoreceptors by confocal microscopy. HDAC4-L175A immunoreactivity (A) was detected in processes (arrow in A) and was excluded from DAPI-stained photoreceptor nuclei (arrow head in A). HDAC4-3SA immunoreactivity (B arrows) was co-localized with the DAPI-stained photoreceptor nuclei (B circles). (C, D) corresponding DAPI images without HDAC4 immunodetection overlay.

12 Fig. S10 HIF1α RNAi blocks HDAC4 survival effect in rd1 mice. HIF1α RNAi screen in transfected 293T cells (A-D). HIF1α sensor HIF1α-IRES-GFP was co-transfected with

13 either shrna to HIF1α or shrna to GAPDH into 293T cells. HIF1α sensor knockdown was assayed 24 hours after transfection. pcag-hcred was cotransfected to monitor the transfection efficiency. (A) HIF1α-IRES-GFP was knocked down by HIF1α RNAi, not by GAPDH RNAi (B), while a comparable number of cells were transfected (C, D). HIF1α RNAi (G, H), but not GAPDH RNAi (E, F), co-electroporated with HDAC4 in rd1 mice at P0 blocks rod photoreceptor survival assayed at P50. Fig. S11 The survival effect by HDAC4 and HIF1αK532R was not additive in the coelectroporation experiment performed in rd1 mice at P0 and assayed at P50 (A-F). (G) Quantification of photoreceptor survival in rd1 mice. The number of Rho-DsRed+ cells was counted per 100 μm section in transfected areas.three to five retinas were scored for each treatment. *** p<0.05 by Student s t-test.

14 References 1. T. Matsuda, C. L. Cepko, Proc Natl Acad Sci U S A 101, (2004). 2. B. Chen, C. L. Cepko, BMC Dev Biol 7, 78 (2007). 3. R. S. Molday, D. MacKenzie, Biochemistry 22, (1983). 4. C. L. Cepko, S. Fields-Berry, E. Ryder, C. Austin, J. Golden, Curr Top Dev Biol 36, (1998). 5. M. A. Dyer, C. L. Cepko, J Neurosci 21, (2001).