Antimorphic goosecoids

Transcription

1 Development 125, (1998) Printed in Great Britain The Company of Biologists Limited 1998 DEV Antimorphic goosecoids Beatriz Ferreiro 1, Michael Artinger 2, Ken W. Y. Cho 2 and Christof Niehrs 1, * 1 Division of Molecular Embryology, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 280, Heidelberg, Germany 2 Department of Developmental and Cell Biology, and Developmental Biology Center, University of California, Irvine, CA , USA *Author for correspondence Accepted 24 December 1997; published on WWW 18 March 1998 SUMMARY goosecoid (gsc) is a homeobox gene expressed in the Spemann organizer that has been implicated in vertebrate axis formation. Here antimorphic gscs are described. One antimorphic gsc (MTgsc) was fortuitously created by adding 5 myc epitopes to the N terminus of gsc. The other antimorph (VP16gsc) contains the transcriptional activation domain of VP16. mrna injection of either antimorph inhibits dorsal gastrulation movements and leads to embryos with severe axial defects. They upregulate gene expression in the dorsal marginal zone and inhibit dorsal mesoderm differentiation. Like the VP16 domain, the N-terminal myc tags act by converting wildtype gsc from a transcriptional repressor into an activator. However, unlike MTgsc, VP16gsc is able at low dose to uncouple head from trunk formation, indicating that different antimorphs may elicit distinct phenotypes. The experiments reveal that gsc and/or gsc-related genes function in axis formation and gastrulation. Moreover, this work warns against using myc tags indiscriminately for labeling DNA-binding proteins. Key words: Gastrulation, goosecoid, myc-tag, Organizer, Xenopus INTRODUCTION At least 17 molecules specific for the amphibian organizer have been described (Bouwmeester et al., 1996; Lemaire and Kodjabachian, 1996; Leyns et al., 1997; Wang et al., 1997). It is a current challenge in vertebrate developmental biology to find out exactly what role each of these molecules plays in the formation of the embryonic axes and how they interact. The gene goosecoid (gsc) was the first Spemann organizer-specific gene discovered (Blumberg et al., 1991) and it encodes a protein that is a member of the paired class of homeodomain proteins. gsc homologs isolated in zebrafish (Stachel et al., 1993), chicken (Izpisúa-Belmonte et al., 1993) and mouse (Blum et al., 1992) are also expressed in the organizerequivalent regions of the gastrula. A gsc homolog was also isolated in human (Blum et al., 1994). These gsc homologs show strong amino acid sequence conservation along their entire length. Based on gsc expression in the organizer of the vertebrate embryo and on gain-of-function studies in Xenopus, it was suggested that gsc plays an important role in vertebrate organizer function (Blum et al., 1992; Cho et al., 1991; Izpisúa- Belmonte et al., 1993; Stachel et al., 1993). Within the Xenopus organizer, goosecoid is expressed in the deep cells that are fated to become prechordal plate or head mesoderm (Cho et al., 1991) and continues to be expressed in the head mesoderm underlying the prospective forebrain at neurula stages (Steinbeisser and De Robertis, 1993). gsc is able to dorsalize dose dependently the marginal zone (Niehrs et al., 1994) and when misexpressed in the side of the Xenopus embryo, it induces cell autonomously a secondary embryonic axis which, however, lacks a head (Cho et al., 1991; Steinbeisser et al., 1993). In addition, gsc may be involved in certain aspects of gastrulation movements, because injected cells show increased involution and migration (Niehrs et al., 1993). In Xenopus, a partial loss of gsc function by injection of antisense mrna results in modest defects in the anterior head region, pointing to a role of gsc in anterior head development (Steinbeisser et al., 1995). In mouse and zebrafish, a second phase of gsc expression during organogenesis was described, most prominently in head mesenchyme and limb buds (Gaunt et al., 1993; Schulte-Merker et al., 1994). Mice in which the gsc gene is inactivated show craniofacial and rib cage defects causing neonatal death, but embryos gastrulate and neurulate normally (Rivera et al., 1995; Yamada et al., 1995). While this indicates that gsc plays an essential role in later development, the absence of axial defects suggests that there may be an early functional redundancy due to related genes (Rivera et al., 1995; Yamada et al., 1995). Indeed, gsc-related genes have been recently described in chicken (gsx) (Lemarie et al., 1997) and in human (Goosecoidlike, GSCL) (Gottlieb et al., 1997). Deletion of the latter gene may be associated with the DiGeorge syndrome (Gottlieb et al., 1997), which is characterized by cardiac defects and characteristic facial features, showing similarities to the gscnull mice. GSCL, gsx and a recently described gsc-related gene in Drosophila (D-gsc; Goriely et al., 1996; Hahn and Jäckle, 1996) show sequence similarity to gsc only in the homeodomain and in an N-terminal stretch of 7 amino acids, called the gsc-engrailed homology region (Goriely et al., 1996). This region appears to mediate part of the transcriptional repression by engrailed in vivo (Smith and

2 1348 B. Ferreiro and others Jaynes, 1996). D-gsc is expressed in ectodermal cells of the nervous system and in the foregut and is required for neurogenesis in postgastrula Drosophila embryos (Goriely et al., 1996; Hahn and Jäckle, 1996). Since the homeodomains of gsc and gsc-related genes are highly conserved, these proteins are likely to bind to identical DNA sequences. Thus, under certain pathological or experimental conditions (e.g. gene inactivation or overexpression), different gsc-related proteins may substitute for each other functionally. Indeed, D-gsc is able to mimic gsc function since it can rescue axis formation in UV-irradiated Xenopus embryos (Goriely et al., 1996). To study early function of gsc, we have characterized two antimorphic variants, MTgsc and VP16gsc, that act in a dominant fashion and thus may overcome compensatory effects that may arise from functional gene redundancy. MTgsc, was constructed fortuitously by adding a 5 mycepitope-tag to its N terminus. The effects of MTgsc and VP16gsc reveal that gsc and/or gsc-related genes are indeed involved in gastrulation and dorsoanterior development. MATERIALS AND METHODS Embryos and explants In vitro fertilization, embryo culture, staging, microinjection and culture of marginal zone explants were carried out as described (Niehrs and De Robertis, 1991). Constructs pmtgsc, a gsc construct with 5 myc epitopes at its N-terminal end, was created by inserting the gsc-encoding fragment obtained from digesting pspgsc (Niehrs et al., 1994) with NcoI-XbaI, into the NcoI- XbaI-digested vector pcs2+mt (Rupp et al., 1994). pspgscf, a gsc construct with the Flag epitope (Brizzard et al., 1994) at its carboxyterminal end, was created by PCR, with the forward (f) primer gggccatggcttctggcatgttcagcattgataac and the reverse (r) primer ccctctagatcacttatcgtcgtcgtccttgtaatcctcgagactgtcagagtccaggtcact; the Flag epitope is encoded by the bold part of the reverse primer. The PCR product was digested with NcoI-XbaI and ligated into the NcoI- XbaI-digested vector pspgsc (Niehrs et al., 1994). pmt gsc, a MTgsc plasmid with the C-terminal part of the molecule including the homeodomain deleted was created by digesting MTgsc with PstI and XbaI, blunt-ending and religating. In the pvp16gsc construct, the N-terminal 131 aa of gsc (until 16 aa N-terminal of the homeodomain) were replaced by the 87 aa activation domain of VP16 (Friedman et al., 1988) by ligating the appropriate DNA fragments. VP16 activation domain was PCRamplified from pcmv-glvp2(h) (Wang et al., 1994) with the primers f: ggggaattcctgatggactcccagcagcc; (EcoRI site and Met codon in bold) and r: gtcaattccaagggcatcggtaaac. The N-terminal truncated gsc was PCR-amplified from pspgsc (Niehrs et al., 1994). with the primers f: ttgtccaggactgagctgcagttgc, and r: gctctcgagtcaactgtcagagtccag (XhoI site and stop codon in bold). These two amplified products were phosphorylated, blunted, EcoRI and XhoI cut, respectively, gel purified and ligated to EcoRI-XhoIdigested pcs vector. To construct pevegsc, the 777 bp even-skipped repression domain (Han and Manley, 1993) PCR-amplified from eve-bsk plasmid (kind gift from G. Ryffel) with the primers f: ggggaattcatgagcacgatcaaggtgtgg (EcoRI site and Met codon in bold) and r: cgcctcagtcttgtagggc, was fused to the same N-terminal truncated gsc fragment as described above in the VP16gsc construct and to the pcs vector. PCR amplifications were carried out with Pfu polymerase (Promega) or Expand TM High Fidelity kit (Boehringer). All constructs were verified by DNA sequencing of junctions. Microinjection experiments pmtgsc, pmt gsc, pvp16gsc, pevegsc and pcsppl (Gawantka et al., 1995) were linearized with Asp718, and pspgsc (Niehrs et al., 1994) and pspgscf were linearized with EcoRI. Linearized plasmids were transcribed with SP6 RNA polymerase using the Megascript kit (Ambion) according to the manufacturer s instructions, using a cap:gtp ratio of 5:1. Colloidal gold lineage tracing and silver staining of embryos were carried out as described (Niehrs et al., 1993). Radial injection refers to microinjection into the equatorial region of all blastomeres at the 4-cell-stage embryo. Animal injection refers to microinjection of all blastomeres into the animal region at the 4- to 8-cell-stage embryo. Ventral and dorsal injections were carried out in Klein embryos (Klein, 1987) at the 4- to 32-cell stage. Immune whole-mount staining and histology Immune whole-mount staining was carried out as described (Dent et al., 1989) using the muscle-specific antibody (Kintner and Brockes, 1984) and the monoclonal antibody to keratan sulfate MZ15 (Zanetti et al., 1985) for labeling notochord. Histological analysis was carried out as described (Niehrs et al., 1994). Time-lapse videomicroscopy Time-lapse recording was carried out using an inverted Nikon Diaphot 300 microscope and epi-illumination using a black and white CCD video camera and digitization (S and L, Jena). 16 frames were averaged every 30 seconds using commercial software (S and L, Jena) and individual frames were processed in Photoshop (Adobe). RT-PCR RT-PCR assays were carried out in the exponential phase of amplification as described (Gawantka et al., 1995; Onichtchouk et al., 1996). Additional primers employed were for Xlim-1 (Taira et al., 1992) (f: actgacttcttcaggagatttgg; r: gttcctcgcctgttgagagc; 154 bp), gsc untranslated region (Blumberg et al., 1991) (f: aggcacaggaccatcttcaccg, r: tggctggggcattcagctatcc; 342 bp), cerberus (Bouwmeester et al., 1996) (f: gctgaactatttgattccacc, r: atggcttgtattctgtggggc; 255 bp) and otx-2 (Blitz and Cho, 1995) (f: ggaggccaaaacaaagtg, r: tcatggggtaggtcctct; 297 bp). Gel-shift assay Gel-shift assays were carried out as described (Wilson et al., 1993), with some modifications. Complementary oligonucleotides for the probes P3C (Wilson et al., 1993) and DE, PE and ATF (Watabe et al., 1995) were synthesized to yield a 5 GATC overhang after annealing. The probes were labeled with Klenow polymerase in the presence of (α- 32 P)dATP. MTgsc, MT gsc and wild-type gsc proteins were synthesized by in vitro translation of capped mrnas transcribed in vitro, in rabbit reticulocyte lysate (Promega). Crude extracts were prepared from BL21 bacteria transformed with either pgst-gsc200 (Artinger et al., 1997) or pgex-kg (GST alone) (Smith and Johnson, 1988). The integrity of proteins was verified by SDS-PAGE analysis. 4 µl of the in vitro translated protein mixture or 1 µl of the protein extract isolated from BL-21 cells were incubated for 15 minutes at room temperature with cts/minute (corresponding to approximately 1 ng) of DNA in a binding buffer consisting of 15 mm Tris-HCl ph 7.5, 60 mm KCl, 0.5 mm DTT, 0.25 mg/ml BSA, 0.5 mm PMSF, 4 mm spermin, 4 mm spermidin, 50 µg/ml poly (didc), 0.5% NP-40 and 7.5% glycerol. 1 µl of a monoclonal antibody specific for the myc epitope (9E10; Evan et al., 1985) was added to the binding mix where indicated. The mixture was analyzed on a 4% polyacrylamide/0.25 TBE gel; the gel was run in 0.25 TBE for 3 hours at room temperature at 10 V/cm. The gels were dried and

3 Antimorphic goosecoids 1349 exposed to Kodak X-OMAT film at 70 C overnight using intensifying screens. DNase protection assay DNase I protection assays were performed essentially as described (Hoey and Levine, 1988). Production of GST-GSC or GST proteins was monitored using SDS-PAGE. Binding reactions were carried out with 5 ng of a 5 32 P-labeled fragment of the gsc promoter and 0.1 µg of poly(didc) in a 50 µl reaction volume for 10 minutes on ice. Samples were electrophoresed on an 8% polyacrylamide/7.5 M urea gel and exposed to film overnight at 80 C with intensifying screens. Luciferase assay 4 DMZ or VMZ explants, 8-10 animal caps or 8 embryos were pooled and homogenized on ice in 50 mm Tris-HCl (ph 7.5). Extracts were centrifuged and luciferase activity was measured in the supernatants as described (de Wet et al., 1987) using a Lumat LB9501 luminometer (Berthold). In pilot experiments, it was checked that Luciferase values (protein normalized and set to one in the control sample) obtained in parallel in animal caps and complete embryos were similar. Protein content of the extract was determined using the Bicinchonic Acid protein assay (BCA-1 kit, Sigma). RESULTS Morphological effects of MTgsc As molecular tools for studies of gsc action, epitope-tagged forms of gsc were constructed containing either 5 myc epitopes at its N terminus (MTgsc) or the Flag epitope at its C terminus (gscf). gscf behaved as wild-type gsc in all assays and, when injected ly into embryos, induced secondary embryonic axes (Fig. 1J; Table 1). Unlike gscf, injection of MTgsc mrna results in relatively normal embryos although, in most cases, the blastopore lip does not close completely and a kinked tail is the visible consequence (Table 1; Fig. 1A). In contrast, dorsally or radially expressed MTgsc mrna has a dramatic effect leading to a high percentage of embryos with gastrulation defects, and anterior and dorsal development defects, as shown by widely open blastopore lip, anterior truncation and a shortened anterior-posterior axis (Table 1; Fig. 1B,C). Immunolabeling of embryos injected with intermediate doses of MTgsc mrna with MZ15 monoclonal antibody (Zanetti et al., 1985) reveals reduction of notochord size. In embryos injected with a high dose, notochords were absent (Fig. 1D-F). Muscle was not affected to the same extent as the notochord in similarly injected embryos, as revealed by staining with the monoclonal antibody (Kintner and Brockes, 1984) (Fig. 1G-I). To test the specificity of action of MTgsc, rescue experiments were carried out. Secondary axis formation induced by injection of either gscf or wild-type gsc mrnas was rescued by coinjection with MTgsc mrna (Table 1; Fig. 1J,K). However, MT gsc, a C-terminal truncated form of MTgsc that lacks the homeodomain, did not rescue secondary axis formation induced by wild-type gsc (Table 1). These data indicate that MTgsc antagonizes gsc action and that the homeodomain is necessary for this effect. Histological analysis of sections through dorsal marginal zone (DMZ) explants at stage 39 shows that a reduction in dorsal-type tissues (such as notochord, neural tissue and cement gland) observed with increasing doses of MTgsc is not accompanied by a proportional increment of more lateral or Fig. 1. MTgsc elicits axial defects and rescues secondary embryonic axis induced by gsc. (A-C) Phenotype of stage-32 embryos expressing MTgsc. (A) 0.4 ng of MTgsc mrna injected into two blastomeres of embryos at the 8- to 16-cell stage. (B) 0.4 ng of MTgsc mrna injected into two dorsal blastomeres of embryos at the 8- to 16-cell stage. (C) Radial injection of increasing doses of MTgsc mrna injected at the 4-cell stage. (D-F) Immunostaining of the notochord with the monoclonal antibody MZ15 (the otic vesicle is also labelled with MZ15). (D) Uninjected control. (E) Embryo injected dorsally with 0.2 ng of MTgsc mrna; all embryos (n=8) showed reduced notochord. (F) Embryo injected dorsally with 0.4 ng of MTgsc mrna; seven out of sixteen injected embryos showed no notochord, the remaining embryos had a smaller notochord. (G-I) Immunostaining of muscle with the monoclonal antibody (G) Uninjected control. (H) Embryo injected dorsally with 0.2 ng of MTgsc mrna; all embryos (n=8) showed a similar phenotype. (I) Embryo injected dorsally with 0.4 ng of MTgsc mrna; all embryos (n=6) showed a similar phenotype. mu, muscle; no, notochord; ov, otic vesicle. (J,K) Rescue of gscf mrna-induced secondary axis formation with MTgsc mrna. (J) Embryo with secondary axis induced by injection of 25 pg of gscf mrna. (K) Rescue of gscf-induced secondary axis formation by coinjecting 100 pg of MTgsc mrna. The arrow points to the secondary axis. type tissues (such as muscle, mesenchyme, pronephros or blood) (Fig. 2A-C). Therefore, it appears that MTgsc causes an inhibition of dorsal differentiation, without provoking a

4 1350 B. Ferreiro and others Table 1. Effect of the injection of various gsc mrnas on embryonic phenotype mrna injected (pg/embryo) Secondary side of injection n axis (%) Other phenotype (%) gsc (25 pg) gscf (25 pg) MTgsc (200 pg) 60 0 kinked tail (78) MTgsc (200 pg) 71 0 open blastopore lip with dorsal truncated or no head (90) no axis (10) MTgsc (100 pg) gsc (25 pg) MTgsc (100 pg) gscf (25 pg) MT gsc (100 pg) gscf (25 pg) evegsc (50 pg) VP16gsc (25 pg) 16 0 kinked tail (30) VP16gsc (25 pg) 40 0 headless (80) dorsal fused eyes (20) VP16gsc (1.6 ng) 20 0 headless with axial and radial gastrulation defects (100) type of differentation. The type of tissue that forms with increasing frequency in the explants from embryos injected with increasing doses of MTgsc (Fig. 2C) has not yet been defined, but it resembles undifferentiated endoderm by morphological appearance. The reduction of notochord differentiation by MTgsc (to 5% in relation to control DMZ, n=20 at 0.8 ng mrna) can be rescued by coinjection of wildtype gsc (78%, n=15 at 0.2 ng mrna; 75%, n=13 at 0.4 ng mrna) (Fig. 2B-D). In contrast, coinjection of mrna encoding the closely related homeobox gene otx2 (Blitz and Cho, 1995) was not able to significantly rescue notochord formation (15%, n=21 at 0.4 ng) (Fig. 2E). This suggests that reduction of notochord differentiation by MTgsc is specific. In conclusion, MTgsc behaves as an antimorphic gsc, since it inhibits dorsal mesoderm development and rescues the characteristic dorsalization of mesoderm induced by wild-type gsc misexpression. MTgsc changes cell fate of dorsal blastomeres To follow the fate of individual cells expressing MTgsc, colloidal gold was injected as a lineage tracer together with MTgsc mrna either into dorsal (B1) or (B4) blastomeres at the 32-cell-stage embryo (Fig. 3). In this mosaic analysis, induced changes of cell fate can be analyzed in the context of an otherwise normal embryo (Niehrs and De Robertis, 1991). B1 normally contributes to the central nervous system, notochord and somites, as shown in the controlinjected embryo (Dale and Slack, 1987; Moody, 1987), (Fig. 3A). However, when MTgsc is expressed in B1, its descendants Fig. 2. The effect of MTgsc on differentation of dorsal marginal zone (DMZ) tissue is rescued by coinjection with wild-type gsc. (A) Histogram of tissue frequency (percentage of explants in which a certain tissue was observed) in stage 39 DMZ explants, as a function of MTgsc mrna-injected dose explants were analyzed per concentration point. (B-E) Paraplast sections of stage 39 DMZ, explanted at early gastrula stage from an uninjected embryo (B), an embryo radially injected with 0.8 ng of MTgsc mrna (C), radially injected with a mixture of 0.8 ng of MTgsc mrna and 0.2 ng of wild-type gsc mrna (D), or a mixture of 0.8 ng of MTgsc mrna and 0.4 ng of otx2 mrna (E). mu, muscle; ne, neural tissue; no, notochord. do not acquire these fates and do not populate the embryonic axes, but instead accumulate anteriorly, forming what appears to be mesenchymal aggregates (Fig. 3B). These cells were clearly alive at the moment of fixation because, at high magnification, it can be seen that they contain extended filopodia and do not have the scattered appearance typical of dead cells. These data confirm the observation by histology that MTgsc expression impedes dorsal differentation and elicits an unidentified cell type. In agreement with the mild phenotype resulting from injections (Fig. 1A), expression of MTgsc in B4 blastomeres does not affect the skin fate of its descendants but reduces muscle fate (Fig. 3C,D).

5 Antimorphic goosecoids 1351 Fig. 3. Fate-change of blastomeres expressing MTgsc. 32-cell-stage embryos were injected into individual blastomeres (indicated in the upper right corner) with colloidal gold-bsa alone (control, left), or with 32 pg MTgsc mrna (right). Embryos were fixed at the tadpolestage and processed for silver staining to visualize the descendants of the microinjected cells. (A,B) Embryos injected into B1 blastomeres. (C,D) Embryos injected into B4 blastomeres. (A) 28 embryos control-injected into B1 showed 100% notochord and somite labeling; no mesenchymal aggregates were found. (B) Of 20 embryos injected into B1 with MTgsc mrna, none had labelled notochord; 65% showed some somite staining, and 90% showed mesenchymal aggregates. (C) Of 12 embryos control-injected into B4, 100% gave skin- and 83% somite staining; (D) Of 21 embryos injected with MTgsc mrna into B4, 100% showed skin- and 57% somite staining. The dorso differences of skin staining between C and D are within normal blastomere fate variation. CNS, central nervous system; ey, eye; ma, mesenchymal aggregate; mu, muscle; no, notochord; sk, skin. MTgsc inhibits dorsal extension movements Gain-of-function studies indicated that gsc is able to induce gastrulation movements and anteriorward migration of mesodermal cells (Niehrs et al., 1993). The open blastopore phenotype of MTgsc-injected embryos (Table 1; Fig. 1B,C) suggested that gastrulation is affected. To further explore which aspects of gastrulation movements are impaired, the effect of MTgsc was studied in in vitro explants as well as in whole embryos by time-lapse videomicroscopy. Control DMZ explants show the characteristic elongation due to autonomous gastrulation movements of convergence and extension (Fig. 4A; Keller and Danilchik, 1988). However, MTgsc inhibits these characteristic elongation movements of the DMZ (Fig. 4A). This inhibition can be reversed by coinjection of wild-type gsc, but not by the organizer-specific homeobox gene Xlim-1 (Fig. 4A). In marginal zone (VMZ) explants, wild-type gsc induces elongation in a bell-shaped dose-dependent manner (Fig. 4B). In contrast, MTgsc is not able to do so even at high doses (Fig. 4C). These results suggest that MTgsc inhibits convergent extension movements. Gastrulation was further studied by analyzing cell movements in whole embryos using time-lapse video microscopy. Control (Fig. 4D) and MTgsc (Fig. 4E) radially injected embryos were recorded from early gastrula to early neurula. Gastrulation proceeds by integration of distinct migratory behaviour of different regions that lead to involution of the mesoderm (Keller and Danilchik, 1988). Convergence or narrowing of tissue occurs to a similar extent all around the blastopore. Extension or lengthening of tissue is characteristic of the dorsal sector and, while it occurs in the side, it is much less pronounced. Two visible consequences of the fact that the latero and cells extend less than the dorsal ones, are (1) that the blastopore closes asymmetrically, near the side, and (2) that the trajectory of dorsal cells is longer than those of ones (Keller, 1991; Keller and Danilchik, 1988). These two features can be seen in the control embryo (Fig. 4D). During the first hour of gastrulation there is no apparent difference between control and experimental embryo. As in the control embryo, a dorsal lip is formed in the MTgscinjected embryo (i.e. bottle cell formation is not inhibited), and cells start to migrate towards the blastopore and involute (Fig. 4E). However, as gastrulation proceeds, it becomes evident that dorsal extension movements are affected. First, as can be seen in frames taken at 90 minute intervals, the blastopore closes symmetrically in the MTgsc embryo and has a larger diameter than in the control. Second, cellmigration trajectories are shorter dorsally: cells that involute at 2.3 hours (arrowheads in summary Fig. 4D,E) were traced (dotted lines) to their position at 0.5 hours. This trajectory is 3.4 times shorter in the dorsal side of the MTgsc-injected embryo than in the control (Fig. 4, summary: dotted lines and arrowheads). Unlike to dorsal cells, the trajectories of ventrolateral cells are on average only 1.5 times shorter in experimental embryos compared to controls. The consequence of the impaired dorsal extension is that the distance traveled by the dorsal lip is 3.7-fold longer in the control than the experimental embryo (Fig. 4 summary: dashed line). This results in a mass of vegetal tissue not covered by the ectoderm, explaining the open blastopore observed (Fig. 1B,C). In conclusion, dorsal extension movements that are driven by active cell intercalation (Wilson and Keller, 1991), but neither dorsal lip formation nor movements, are significantly affected by MTgsc. MTgsc izes gene expression in DMZ We next asked whether the phenotypic effects observed after MTgsc injection were reflected in an altered expression pattern of dorsal/ marker genes in the marginal zone mesoderm. Gene expression in the marginal zone was studied by RT-PCR in embryos that were either uninjected (control, co) or injected radially with gscf, MTgsc or MT gsc. As shown previously for wild-type gsc (Niehrs et al., 1994), gscf induces in the VMZ dorsal marker genes (chordin, Sasai et al., 1994; Xlim-1, Taira et al., 1992; and otx-2, Blitz and Cho, 1995) and represses marker genes (Bmp-4, Nishimatsu et al., 1992; Xvent- 1, Gawantka et al., 1995; Xvent-2, Onichtchouk et al., 1996; Xhox-3, Ruiz i Altaba and Melton, 1989; Xwnt-8, Smith and

6 1352 B. Ferreiro and others Fig. 4. MTgsc inhibits dorsal extension movements. (A-C) Effect of gsc and MTgsc on in vitro marginal zone elongation. (A) Control (uninjected) dorsal marginal zone (DMZ) explants elongate (n=15, 93%) whereas elongation is completely inhibited in DMZ explants of embryos injected radially with 0.8 ng of MTgsc mrna (n=17). Inhibition of DMZ elongation with 0.8 ng of MTgsc mrna could be rescued by coinjection with 0.2 ng of wtgsc mrna (n=18, 83% elongation); but not by coinjection with 0.4 ng of Xlim-1 mrna (n=7). (B,C) Elongation of marginal zone (VMZ) explants from uninjected embryos or from embryos radially injected with the indicated dose of gsc mrna (B), or MTgsc mrna (C). (B) VMZ explants of embryos injected with increasing doses of gsc mrna elongate in a bell-shaped dose-dependent manner. (C) VMZ explants of embryos injected with increasing doses of MTgsc do not elongate. DMZ and VMZ were explanted at early gastrula stage, and elongation was scored at stages 18 to explants were analyzed for each concentration. (D,E) Timelapse videomicroscopy recording of gastrulation in an uninjected embryo (D) and an embryo radially injected with 0.1 ng MTgsc mrna (E). Embryos in vegetal view were recorded from the early gastrula until the early neurula stage. Single frames at the indicated times are shown. The white arrowhead points to the dorsal lip. Note that the blastopore closes towards the side in the control embryo (D), but concentrically in the injected embryo (E). In the control embryo, the blastopore is closed at 6.5 hours (D), but it is still widely open in the injected embryo (E). In the summary, the initial shape of each embryo is drawn. The movement of the dorsal lip between 0.5 hours and 6.5 hours is indicated by a dashed line. Cells that involute at 2.3 hours (arrowheads) are traced (dotted lines) to their position at 0.5 hours. Note that the trajectory of the recorded dorsal cells is shorter (3.4 times) in the MTgsc-injected embryo than in the control embryo. Ventral cells are much less affected. Three experimental and two uninjected embryos were analyzed, showing results similar to the one presented in this figure. Harland, 1991; Fig. 5). In contrast, MTgsc induces in the DMZ all -type genes tested and downregulates the dorsal marker genes with the notable exception of cerberus (Bouwmeester et al., 1996) and gsc (Blumberg et al., 1991) itself, which are upregulated. In addition, MTgsc also induces endogenous gsc in the VMZ. The effects of MTgsc are dependent on the homeodomain, since MT gsc injection does not affect marker gene expression. In summary, the dorsal marginal zone of a MTgsc-injected embryo misexpresses -type genes but, as shown in Figs 2C and 3B, it does not differentiate as mesoderm. MTgsc acts as a transcriptional activator We next investigated the DNA-binding and transcriptional capacities of MTgsc in comparison to wild-type gsc. Using a band-shift assay, we first addressed whether MTgsc protein is able to bind to the double-stranded oligonucleotide P3C, containing the consensus DNA-binding site selected by a gsc homeodomain peptide (Wilson et al., 1993). MTgsc causes a similar shift in the mobility of the probe as gsc, whereas MT gsc does not cause a shift (Fig. 6A). Inclusion of an antimyc monoclonal antibody causes a supershift with MTgsc but not with gsc, confirming that MTgsc is the binding protein (Fig. 6B). Therefore the presence of the 5 myc epitopes does not impair the binding of the gsc homeodomain of MTgsc to DNA. Next, we analyzed the effect of wild-type gsc and MTgsc on the expression of a promoter reporter gene construct (p- 226gsc/Luc; (Watabe et al., 1995) in which 226 bp of the gscpromoter drive the luciferase gene. This promoter includes two elements (DE, PE) that are required for an efficient and faithful regulation of gsc in vivo (Watabe et al., 1995). The DE contains

7 Antimorphic goosecoids 1353 Fig. 5. MTgsc induces gene expression. Embryos were either uninjected (co) or injected radially at the 4-cell stage with gscf mrna (50 pg), MTgsc mrna (0.4 ng), or MT gsc mrna (0.4 ng). DMZs and VMZs were explanted at early gastrula stage and incubated until uninjected sibling embryos reached stage 15. RNA was prepared and analyzed by RT-PCR for expression of the dorsal and marker genes indicated, and histone H4 as loading control. The experiment was repeated in three batches of embryos, and in two other stages of development (stage 11 and stage 20) with similar results. RT indicates uninjected control samples without reverse transcription. an almost perfect P3C sequence (TAATCAGATTA versus TAATCCGATTA, different nucleotide underlined). Coinjection of wild-type gsc mrna and p-226gsc/luc Fig. 6. MTgsc binds to a gsc target sequence. (A) Binding of the indicated in vitro translated proteins to P3C (Wilson et al., 1993), a consensus DNA-binding sequence for gsc; the control lane contains unprogrammed in vitro translation mixture and shows a non-specific shift. (B) Effect of anti-myc antibody on the binding of the indicated proteins. The arrows in A and B indicate the specifically shifted probe, and the arrowhead in B indicates the supershifted probe in the presence of the anti-myc antibody. FP, free probe; NS, non-specific shift. results in an inhibition (2.2-fold) in luciferase activity in animal caps relative to p-226gsc/luc injected alone (Fig. 7A). However, coinjection of MTgsc mrna and p-226gsc/luc results in a 26-fold increase in luciferase activity in animal caps relative to p-226gsc/luc injected alone and this activation is inhibited by an equimolar amount of gscf (Fig. 7A). By contrast, MT gsc does not activate luciferase in the animal cap (Fig. 7A). MTgsc also activates reporter gene expression in the dorsal and the marginal zone (Fig. 7B). These results are in agreement with the RT-PCR study (Fig. 5), where MTgsc induces gsc expression in DMZ and VMZ explants and point to a transcriptional activation mechanism of action of MTgsc. Furthermore, as in the animal cap, gscf has a clear inhibitory action in the VMZ relative to control (Fig. 7B; 2.7-fold), behaving as a transcriptional repressor. To test whether these effects are due to direct binding of the gsc homeodomain to its own promoter, we performed gel-shift analysis using the two elements, PE and DE that are required for the efficient and faithful regulation of gsc in vivo (Watabe et al., 1995). For this experiment, a 17 bp aspect of the DE (DE17) was used as probe. A fusion protein of the glutathione- S-transferase (GST) domain with the gsc homeodomain (GST- Gsc, Artinger et al., 1997) or GST protein alone were utilized. The Gsc HD is clearly able to shift the DE17 region whereas the GST domain alone is not (Fig. 8A). The affinity of this interaction is significant as demonstrated by the relatively high levels of non-specific competitor needed to affect binding (Fig. 8A). Unlabelled oligonucleotides corresponding to the DE and PE regions of the gsc promoter were used as specific competitors and an oligonucleotide corresponding to the nonessential ATF site in the gsc promoter (Watabe et al., 1995) was included as a negative control. Figure 8B demonstrates that Gsc HD shifts the DE17 element and that >10-fold excess of unlabelled DE17 is necessary to successfully compete away binding from the probe. Although the binding dynamics of the PE element (PE4) are different from the DE, it can also compete for binding with the DE. The ATF region, however, is unable to affect the association of the Gsc HD with the DE even at 100 excess.

8 1354 B. Ferreiro and others Fig. 7. MTgsc and wild-type gsc act as transcriptional activator and repressor, respectively. (A) 4- to 8-cellstage embryos were injected in all animal blastomeres with 0.1 ng of reporter plasmid p-226gsc/luc and the following mrnas: 0.4 ng of PPL mrna (control), 1 ng of gscf, 1 ng of MTgsc, 0.65 ng of MT gsc (equimolar in relation to MTgsc), or 1 ng of gscf + 1 ng of MTgsc. (B) 4-cell-stage embryos were injected equatorially with 0.1 ng of reporter plasmid p- 226gsc/Luc in the presence of 0.4 ng of PPL mrna (control), 0.2 ng gscf mrna, or 1 ng of MTgsc mrna. (A) Animal caps were dissected at late blastula stage; (B) DMZ and VMZ were dissected at early gastrula stage. Explants were analyzed immediately after dissection for luciferase activity and protein content. Luciferase data are normalized to protein content and are arbitrarily set at one in the control experiments (control VMZ in B). Relative luciferase activity A Control gscf MTgsc animal cap MT gsc MTgsc + gscf B Control gscf VMZ MTgsc Control gscf DMZ MTgsc To provide additional support for the ability of the Gsc protein to interact with its own promoter, we performed a DNase protection assay using the first 350 bases of the gsc promoter as a probe (Fig. 9). Two distinct regions corresponding to the PE and DE sites are clearly protected by the GST-GSC fusion protein and not by the GST domain itself. In conclusion, these results show that MTgsc appears to be a strong transcriptional activator whereas wild-type gsc functions as transcriptional repressor, consistent with the recent finding that gsc directly represses Xbra transcription (Artinger et al., 1997). VP16gsc and MTgsc have similar effects While we have shown that MTgsc acts as a transcriptional activator, the effect of the fused myc epitopes was unpredicted and cannot be readily understood since the myc epitope had not been previously shown to confer transcriptional activation. To provide independent evidence for the effect of an antimorphic gsc, we replaced the gsc N terminus with the well-characterized transcriptional activation and repression domains of VP16 (VP16gsc) and even-skipped (evegsc), respectively. We first tested the transcriptional activity of VP16gsc. Coinjection of VP16gsc mrna and p-226gsc/luc results in a 10-fold increase in luciferase activity in animal caps relative to p- 226gsc/Luc injection alone. Surprisingly, MTgsc leads consistently to a much stronger induction of luciferase activity than VP16gsc (Fig. 10A). Ventral injection of VP16gsc mrna did not induce secondary embryonic axes but the kinked tail phenotype observed with MTgsc (Table 1). In contrast, injection of evegsc mrna into the side led to secondary embryonic axis formation, similar to wild-type gsc injection (Table 1). Radial or dorsal injection of VP16gsc at low dose inhibited head formation (Table 1; Fig. 10C). This phenotype is clearly different from that of MTgsc, where inhibition of head and axis formation could not be uncoupled. At high dose, VP16gsc also interfered with axis formation and gastrulation similar to MTgsc (Table 1; Fig. 10D). Like MTgsc, VP16gsc inhibits in DMZ chordin (Sasai et al., 1994) expression and induces the markers Bmp-4 (Nishimatsu et al., 1992) and Xwnt-8. (Smith and Harland, 1991). In addition, VP16gsc superinduces endogenous gsc, as observed following MTgsc injection (Fig. 10E). Thus, both VP16gsc and MTgsc activate transcription, ize dorsal marker gene expression and are able to inhibit head and axis formation. However, they are different with respect to their ability to delete head formation without affecting the trunk, which can be achieved by low doses of VP16gsc but is never observed with MTgsc. Fig. 8. Gsc protein binds to the gsc promoter. (A) Band-shift assays using GST-Gsc and GST proteins and a labeled 17mer of the distal element (DE-17). The concentration of unspecific competitor DNA poly(didc) was varied as indicated. Note that more than 10 µg of nonspecific competitor are required to compete binding. (B) Band-shift assays using GST-Gsc protein and a labeled 17mer of the distal element (DE-17). Competition was carried out with the indicated excess of unlabeled DE17, PE4 and ATF regions of the gsc promoter. Note that DE and PE4 are able to specifically compete binding, but not ATF. No comp., no competitor added; FP, free probe. The arrowheads indicate the specifically shifted probe.

9 Antimorphic goosecoids 1355 Fig. 9. GscHD binds both the DE and PE in the gsc promoter. DNase I protection analysis of a 3 labeled 350 bp fragment of the gsc promoter. Two sites corresponding to the distal element (DE) and proximal element (PE) are protected by the GST-Gsc protein and not by GST alone. Amounts of GST-Gsc or GST (control) protein extract used are: lanes 2 and 9, 0.08 µg; lanes 3 and 10, 0.4 µg; lanes 4 and 11, 2.0 µg; lanes 5 and 12, 5.0 µg; lanes 6 and 13, 10 µg. NP, no protein extract added. Epistatic relationship with siamois and chordin Using these two antimorphic gsc constructs, we tested the hierarchical relationship of gsc action with respect to the organizer-specific genes siamois and chordin. siamois is a downstream target of the Nieuwkoop center and injection of siamois mrna induces complete secondary embryonic axes (Lemaire et al., 1995) (Fig. 11A). This effect is partially blocked by coinjection of either MTgsc or VP16gsc, which leads to incomplete secondary axes that only contain a trunk (Fig. 11B,C). chordin is an organizer-specific effector that can be induced by gsc mrna injection (Sasai et al., 1994). Ventral injection of chordin mrna induces secondary embryonic axes that are incomplete and do not contain a head (Sasai et al., 1994) (Fig. 11D). This effect could not be blocked by coinjection of low doses of either MTgsc or VP16gsc (Fig. 11E,F). These results support a requirement for gsc in head formation. They are consistent with the following order of gene action in dorsal axis formation: sia gsc chordin. DISCUSSION In the present study, MTgsc, an epitope-tagged form of gsc with 5 myc-epitopes at its N terminus, is characterized and identified as an antimorphic gsc. This conclusion is based on the following observations after MTgsc mrna injection: (1) rescue of secondary axis formation induced by gsc wildtype; (2) specific inhibition of dorsal differentation in embryos, in dorsal marginal zone explants and in the descendants of the dorsal blastomere B1; (3) induction of gene expression Fig. 10. VP16gsc is an antimorphic gsc. (A) Both VP16gsc and MTgsc act as transcriptional activators. 4- to 8-cell-stage embryos were injected in all animal blastomeres with 0.1 ng of reporter plasmid p-226gsc/luc and the following mrnas: 0.4 ng of PPL mrna (control), 0.8 ng of VP16gsc or MTgsc mrnas (low), or 1.6 ng of VP16gsc or MTgsc mrnas (high). Embryos were analyzed at stage 11 for luciferase activity and protein content. Luciferase data are normalized to protein content and arbitrarily set at one in the control experiment. (B-D) VP16gsc mrna injection blocks head formation at low dose and provokes also axial and gastrulation defects at high dose. (B) Uninjected control embryo; (C,D) phenotype of embryos injected at the 4-8 cell stage into two dorsal blastomeres with 0.1 ng (C) or radially 1.6 ng (D) of VP16gsc mrna. (E) VP16gsc induces gene expression. Embryos were either uninjected (embryo, control DMZ) or radially injected at the 4- cell stage with 0.4 ng (low) or 0.8 ng (high) of VP16gsc mrna. DMZs (control and VP16gsc injected) were explanted at early gastrula stage and incubated until uninjected sibling embryos reached stage 15. RNA was prepared and analyzed by RT-PCR for expression of the dorsal and marker genes indicated, and histone H4 as loading control. Note reduction of chordin and induction of Bmp-4 and Xwnt-8 expression. ( RT), minus reverse transcriptase control. in the dorsal marginal zone; (4) repression of dorsal gastrulation movements and (5) activation of a promoter that

10 1356 B. Ferreiro and others Fig. 11. Hierarchical relationship between siamois, chordin and gsc. (A-C) Secondary head formation induced by siamois is inhibited by coinjection of MTgsc and VP16gsc. (A) Ventral coinjection at the 8- to 32-cell stage of 2.5 pg siamois mrna and 0.1 ng PPL mrna (n=44) induced 66% of complete secondary axis (with head), and 25% of incomplete secondary axis formation. Coinjection of siamois mrna with 50 pg MTgsc (n=49) (B) or 50 pg VP16gsc (n=30) (C) induced only incomplete secondary axis formation (61% and 60%, respectively). (D-F) Secondary axis formation induced by chordin mrna is not inhibited by coinjection of MTgsc or VP16gsc. (D) Ventral injection of coinjection of 0.1 ng chordin mrna with PPL mrna (0.2 ng) induced 60% secondary axis formation (n=43); (E) with MTgsc mrna at 0.1 ng (n=30), 53% of embryos show secondary axis; (F) with 0.2 ng VP16gsc mrna (n=38) and 0.4 ng (n=32), 50% and 68% of embryos show secondary axis, respectively. Arrows mark secondary axes. is repressed by wild-type gsc. These results are corroborated by the observations made with an antimorphic VP16gsc construct. Mechanism of MTgsc action MTgsc appears to antagonize gsc by a transcriptional mechanism. It binds to the same DNA sequence as gsc, activates the same genes in the DMZ that are repressed by gsc in the VMZ and represses in the DMZ the same genes that are upregulated by gsc injection in the VMZ. MTgsc also strongly activates gene expression from a reporter plasmid whose promoter contains gsc-binding sites. Wild-type gsc represses transcription of the same reporter plasmid in VMZ and animal cap explants, demonstrating that gsc can function as a transcriptional repressor. Furthermore, even-skipped repressor and VP16 activator fusion constructs with gsc behave like wild type and antimorph, respectively. These results are consistent with the observation, that gsc is a direct repressor of Xbra (Artinger et al., 1997). In agreement with this, gsc contains at its N-terminal end a domain called goosecoidengrailed homology region, which is conserved in engrailed proteins and accounts for part of their repressor function (Smith and Jaynes, 1996). Therefore, the primary role of gsc in the organizer may be to repress transcription of izing genes. How does the myc-tagging affect gsc? The putative transcriptional repressor domain of gsc may be masked by the myc domain in MTgsc protein. In addition, the myc domain may behave as an activation domain of transcription. The myc epitope is derived from the leucine zipper domain of the transcription activator factor c-myc (Landschulz et al., 1988). In the penta myc-epitope tag, the required leucine spacing for a leucine-zipper is not preserved. However, this domain contains 25 acidic amino acids out of a total of 65. A strong net negative charge is a characteristic shared by other transcriptional activation domains and the penta-myc tag has a predicted alpha helical structure (not shown) which is an additional determinant for activators (Giniger and Ptashne, 1987; Ruden, 1992). The multi-myc tag is widely used in pcs2-mt vectors (Rupp et al., 1994). For example, this penta-myc epitope has been incorporated into the transcription factor MyoD, but an antimorphic effect of MTMyoD was not reported (Rupp et al., 1994). However, MyoD is a transcriptional activator (Rupp et al., 1994), and addition of the MT activator domain may not appreciably change its properties. We note, however, that addition of myc tags does not significantly influence the activity of the Xvent-1 repressor (D. Onichtchouk, B. F. and C. N., data not shown), suggesting that myc-tags do not universally confer transcriptional activation. It is important to be aware of the possibility of creating an antimorphic form of a protein when myc-tags are added to a transcription factor. Specificity of the observed effects The approach to generate a phenotypic loss-of-function of transcription factors by manipulating their transcriptional activity is now widely used (Bellefroid et al., 1996; Conlon et al., 1996; Ryan et al., 1996; Fan and Sokol, 1997; Horb and Thomsen, 1997; Hudson et al., 1997; Marine et al., 1997). For the interpretation of the phenotypes, the specificity of the effects observed is critical and the criteria that are commonly used are as follows. (1) The effects may be rescued by wildtype construct. This experiment ensures that manipulating the transcription factor does not create unphysiological DNA targets that would not be titrated out by the wild-type. For MTgsc, we show successful rescue experiments for secondary axis induction, notochord differentiation, DMZ elongation and transcriptional activation of a reporter construct. (2) The phenotype is likely to show a character opposite to the phenotype observed with the wild-type construct. We show that MTgsc behaves in an opposite manner to wild-type gsc regarding dorsal marker gene expression, effect on gastrulation movements and transcriptional activation of a reporter construct. We note, though, that both MTgsc as well asvp16gsc induce a kinked tail in injections, where no zygotic gsc is expressed. This may be due to interference with maternal Gsc protein (Cho et al., 1991) or with a putative Xenopus gsx-homolog, which in chicken is expressed in the posterior primitive streak (Lemarie et al., 1997), corresponding to the marginal zone in Xenopus. A further argument for the specificity that we present here for the first time, is the comparison of two independent kinds of antimorphs for the same gene, which should give similar effects. This is largely the case for the VP16gsc and MTgsc constructs. We note, however, that the two constructs behave differently with respect to their ability to uncouple head from trunk formation. This may be related to the much higher transcriptional

11 Antimorphic goosecoids 1357 activation ability of MTgsc compared to VP16gsc and points out that transcription factor antimorphs made with different activator/repressor domains may elicit distinct phenotypes. In conclusion, our data attest to the specificity and physiological relevance of the observed effects in as much as the antimorphic approach can be controlled. However, inherently, we cannot exclude the possibility that genes are affected by these constructs that are neither targets of gsc nor of other gsc-family members, but contain gsc target recognition sites. gsc autoregulation MTgsc and gsc injection experiments in animal cap and in VMZ indicate that gsc may be repressing its own expression. However, in the DMZ, unlike in animal caps and VMZ explants, wild-type gsc does not repress the activity of the gscpromoter nor does it downregulate endogenous gsc expression. The physiological relevance of gsc autorepression is therefore unclear. The DMZ may be resistant to autorepression due to the presence of endogenous activating signals (such as activins, vg1 and components of the wnt signaling pathway; Watabe et al., 1995) that are able to maintain gsc expression and that cannot be overcome by the repressing activity of wild-type gsc. Since gsc acts as a repressor, the autoactivation of gsc expression seen at high doses (Niehrs et al., 1994), is probably indirect and results from derepression of dorsal genes. The fact that mrna injection of MTgsc, VP16gsc (this study) and wildtype gsc (Niehrs et al., 1994) increase the endogenous gsc expression in the marginal zone may point to a complicated regulatory loop for gsc expression. This point is currently being addressed. Early embryonic function of gsc The DMZ of a MTgsc-injected embryo expresses marker genes, at a even higher level than a control VMZ and some dorsal marker genes. Yet, there is no proportional shift from a dorsal into a more lateral or type of tissue differentation, but rather a shift into an unidentified cell type. These results make two important points: (1) gsc and/or gsc-related genes function in dorsal mesoderm (organizer) differentiation and (2) in contrast to the current view, the inhibition of dorsal mesoderm differentation does not necessarily lead to mesoderm differentiation. This may indicate that key factors necessary for lateral and/or differentation are missing in the MTgsc-injected dorsal cells. Alternatively, the simultaneous presence in the DMZ of and some dorsal type gene transcripts (gsc, cerberus) may cause inhibition of dorsal development, while not allowing for development. An important function of organizer mesoderm is to drive gastrulation. In Xenopus, it was shown that gsc expression in the side induces dorsal gastrulation movements and overexpression in the organizer increases anterior cell migration (Niehrs et al., 1993). In MTgsc-injected embryos, we observe that dorsal extension movements are strongly inhibited while neither bottle cell formation nor movements were significantly affected. These results indicate a function for gsc in gastrulation. An early requirement for gsc in Xenopus was also suggested by loss-of-function experiments using antisense RNA injection (Steinbeisser et al., 1995). However, the phenotype is less severe, resulting in head defects similar to those obtained with low doses of VP16gsc, without gastrulation defects or major changes in mesoderm differentiation as observed with MTgsc mrna injection. This difference in phenotype may reflect at least two aspects of the different mechanisms by which both RNAs act. First, in the antisense approach gsc expression is eliminated, which likely leads to derepression of gscresponsive genes. These genes are, however, strongly activated by MTgsc. Second, the antisense approach results in a likely specific inactivation of gsc, whereas MTgsc can probably also interfere with the action of redundant gsc-like genes with similar target gene specificity, such as amphibian homologs of gsx (Lemarie et al., 1997) and GSCL (Gottlieb et al., 1997). In keeping with this possibility, in the chick, gsc and gsx have an early common expression pattern in the early primitive streak (equivalent to the marginal zone in Xenopus) and their expression domains segregate during gastrulation (Lemarie et al., 1997); gsc-expressing cells in the anterior end of the primitive streak (equivalent to the dorsal marginal zone) gastrulate and induce neuralization, while gsx-expressing cells in the posterior end of the primitive streak (or marginal zone) neurulate and induce gastrulation. Based on gain-of-function experiments and the timing of gene expression, it was proposed that organizer genes may be regulated by siamois (Carnac et al., 1996; Fagotto et al., 1997; Fan and Sokol, 1997), while chordin may be a target gene for gsc (Sasai et al., 1994). Our epistasis experiments provide direct evidence for a hierarchical relationship of the order sia gsc chordin. In summary, we have shown that a myc epitope tag may change, in a dramatic way, the activity of a transcription factor. By characterizing the effects of MTgsc as well as VP16gsc,we have demonstrated that gsc and/or gsc-related genes are indeed required for proper gastrulation and dorsoanterior development. The distinct effect of VP16gsc over MTgsc to uncouple head from trunk formation highlights that different kinds of antimorphs may elicit different phenotypes. These antimorphic gsc constructs will be useful to dissect the roles that gsc and potential gsc-related genes play in development. Furthermore, they may help to identify target genes of gsc, e.g. by differential screening. We are grateful to C. Blumenstock for technical assistance and to Dr R. Hartong, D. Onichtchouk and F. S. J. de Souza for useful comments and critical reading of the manuscript. We thank Drs M. Eilers, A. Glinka, B. Lutz, R. Rupp, G. Ryffel and M. Taira for reagents, and I. Schuster for expert histology. This work was supported by grant Ni 286/4-1 from the Deutsche Forschungsgemeinschaft to C. N., and a fellowship of the European Community to B. F. REFERENCES Artinger, M., Blitz, I., Inoue, K., Tran, U. and Cho, K. W. (1997). Interaction of goosecoid and brachyury in Xenopus mesoderm patterning. Mech. Dev. 65, Bellefroid, E. J., Bourguignon, C., Hollemann, T., Ma, Q., Anderson, D. J., Kintner, C. and Pieler, T. (1996). X-MyT1, a Xenopus C2HC-type zinc finger protein with a regulatory function in neuronal differentiation. Cell 87, Blitz, I. L. and Cho, K. W. (1995). Anterior neurectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development 121,