MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle. Pamela Mukhopadhyay Winter School 5 th July 2016

Transcription

1 MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle Pamela Mukhopadhyay Winter School 5 th July 2016

2 Presentation overview Introduction sequencing analysis Identifying targets biogenesis Function Interactions Sequencing alignment isomirs When is a expressed? Bioinformatics approaches, and why they suck. Experimental approaches. Understanding network biology. Queensland Institute of Medical Research 2

3 s function through mrna targets Drosha Processing 5 3 pri- 5 3 pre- Dicer Processing 5 3 duplex Asymmetrical Unwinding AAAAAAAAAAAAAA 3 mrna Translational Inhibition mrna sequestration mrna degradation RISC-mRNA interactions 3 RNA-Induced Silencing Complex (RISC) 5 QIMR Berghofer Medical Research Institute 3

4 MicroRNAs are small and closely related Pro Length of s (nt) mir-17-5p : mir-20 : mir-106a : mir-106b : mir-93 : mir-18 : UGUGCAAAUCUAUGCAAAACUGA- UGUGCAAAUCCAUGCAAAACUGA- UGUGCAAAUCCAUGCAAAACUGAmiR-19a : mir-19b-1 : mir-19b-2 : CAAAGUGCUUACAGUGCAGGUAGU UAAAGUGCUUAUAGUGCAGGUAG- AAAAGUGCUUACAGUGCAGGUAGC UAAAGUGCUGACAGUGCAGAU--- -AAAGUGCUGUUCGUGCAGGUAG- UAAGGUGCAUCUAGUGCAGAUA--

5 Modes of binding Seed site (common) 3 supplementary site (rare) mrna mrna 3 compensatory site (rare) Centered site (rare) Imperfect Centered site (common) mrna mrna mrna Adapted from Brennecke et al., (2005) PLoS Biology 3:e85 Queensland Institute of Medical Research 5

6 20 papers per day QIMR Berghofer Medical Research Institute 6

7 QIMR Berghofer Medical Research Institute 7

8 Presentation overview Introduction sequencing analysis Identifying targets biogenesis Function Interactions Why I hate s. Sequencing alignment isomirs When is a expressed? Bioinformatics approaches, and why they suck. Experimental approaches. Understanding network biology. Queensland Institute of Medical Research 8

9 Aligning to the genome

10 Not allowing mismatches does not solve the problem Your reference genome will contain mir A tagcgggatctctcgagagctcgcgat polymorphisms 0 1 MM Your sample will contain tctctcgagagct tctctcgacagct amplification or sequencing artifacts 1 0 MM Unique mir B alignment tagcgggatctctcgacagctcgcgat is not the same as specific alignment

11 Alternatives to genome alignment 5 3 pri- transcript Could also be pre-mrna transcript with s in the introns 1000s nt long Often not fully defined Will miss novel s 5 3 pre- hairpins nt long Will miss novel s 3 5 Mature s nt long Will miss novel s Will not detect isomirs Best curated resource for s is currently now with high confidence predictions QIMR Berghofer Medical Research Institute 11

12 IsomiRs are common and functional 5 3 pre- Cloonan et al. Genome Biol 2011; 12(12):R126

13 isomirs are active s Cloonan et al. Genome Biol 2011; 12(12):R126

14 Some good news! Yes you have to account for isomirs in your study design... Yes you have to adjust your bioinformatics to cope with isomirs... However, s and isomirs act cooperatively to target the same pathways Cloonan et al. Genome Biol 2011; 12(12):R126 QIMR Berghofer Medical Research Institute 14

15 Expression Thresholding The every tag is sacred approach will make you sad. Cloonan et al. Genome Biol 2011; 12(12):R126

16 Presentation overview Introduction sequencing analysis Identifying targets biogenesis Function Interactions Why I hate s. Sequencing alignment isomirs When is a expressed? Bioinformatics approaches, and why they suck. Experimental approaches. Understanding network biology. Queensland Institute of Medical Research 16

17 Bioinformatics approaches to target prediction Assumptions have to be made to achieve any kind of specificity 5 UTR Coding Region 3 UTR Human Chimp Mouse Rat Dog ATG ATG ATG ATG ATG AAA AAA AAA AAA AAA Conserved regions in 3 UTRs Best have 50% false positive rates, and at least 40% false negative rates QIMR Berghofer Medical Research Institute 17

18 Target detection methods Luciferase assays Predicted binding Site to test Mutate the predicted binding site Promoter Luciferase Gene 3 UTR Promoter Target mrna 3 UTR add Luciferase proteins can be assayed by the release of light after the addition of a substrate Wildtype binding site Mutated binding site Genomic mutation Microarray assays Look for downregulated genes 5 AAAAA 3 increase decrease Look for upregulated genes AAAAA 3 AAAAA 3 AAAAA 3 AAAAA 3 5 mrna 3 adaptor 5 adaptor AAAAA 3 3 adaptor Degradome sequencing QIMR Berghofer Medical Research Institute 18

19 Target detection methods HITS-CLIP Biotin Pull-down Martin et al., QIMR Genome Berghofer Medical Biology, Research 2014 Institute 15:R51 19

20 Ørom et al., 2008 mir-10a p = p = fold-change threshold Luciferase TargetScan significance threshold Martin et al., Genome Biology, :R51

21 Cloonan et al., 2011 mir-10a p = p = fold-change threshold Luciferase TargetScan significance threshold Martin et al., Genome Biology, :R51

22 targeting network Nodes Enriched in G1/S checkpoint genes Anti-proliferation Pro-proliferation Confirmed target of mir-17-5p Possible target of mir-17-5p Edges Direct interaction (requires physical contact) Indirect interaction (does not require physical contact, or physical contact unknown) Cloonan et al., Queensland Genome Institute Biology, of Medical Research :R127 22

23 Evasion of targeting AAAAAAAAAAAAAA 3 mrna AAAAAAAAAAAAAA 3 5 AAAAAAAAAAAAAA 3 5 AAAAAAAAAAAAAA 3 Cloonan et al., Genome Biology, :R127

24 Time to wake up now Conclusions

25 Advice on getting your paper accepted Question your assumptions Just because it was published in Nature, doesn t make it correct. Follow up citations. Understand your analysis Alignment strategy/tools and limitations Library construction and limitations Statistical assumptions for differential expression Yes, replicates are required. And controls. Statistical significance is not the same thing as biological importance

26 Acknowledgements Genomic Biology Lab, QIMR Berghofer Medical Research Institute Nicole Cloonan (Lab Head) Shivangi Wani Vandhana Bharti Rob Luetterforst Queensland Institute of Medical Research 26

27 All done! W qimrberghofer.edu.au E pamela.mukhopadhyay@qimrberghofer.edu.au QIMR Berghofer Medical Research Institute 27