SUPPLEMENTARY INFORMATION

Transcription

1 SULEMENTARY INFORMATION doi: /nature12117 Supplementary Discussion Although loss of leads to initiation of postembryonic development even under starvation conditions, ectopic overexpression of under fed conditions does not seem to be sufficient to suppress development; we noticed that daf-2(e1370) mutant animals showed delayed initiation of cell migration at 25.5 C, compared to. However, introduction of (n4504) does not alleviate this delay in the daf-2 mutant animals (Kasuga et al., unpublished data). This observations imply that overexpression of in the mutant does not contribute to the delay in cell migration. Alternatively, daf-2(e1370) may impair an additional pathway that promotes progression of L1 development in a -independent manner. Furthermore, our preliminary data showed that animals carrying an array that drives expression of under the control of the dpy-7 promoter, in which is presumably overexpressed during fed conditions, display neither constitutive L1 arrest, nor delay in cell migration, nor any other obvious developmental defect. Altogether, we suggest that feeding conditions can overcome the antagonistic action of to promote postembryonic development in some way, even when levels of the mirna stay relatively high. On the other hand, loss of nhr-91 results in neither constitutive L1 arrest nor delay in cell migration (Kasuga et al., unpublished data), and we did not notice any obvious developmental defect. These observations suggest that there exists an additional mir-235 target gene(s) other than nhr-91 that play(s) an important role in promoting postembryonic development. Simultaneous inhibition of such genes activity could result in either constitutive L1 arrest or delayed cell migration. Supplementary Methods Construction of plasmids Brief description of each construct is below. Details are available upon request. genomic region: A CR fragment amplified with primers 1

2 SULEMENTARY INFORMATION TAGTCGACTGTATTGTTCAGACCACTCCCT and CAGAACAGTGCAAGAAATT TGAGAA was subcloned into pgem-t easy (romega). *: Mutations were introduced the CR-based method using primers ATTTT ACTCTCCCCGGCCTGATCTGAGAGTAAGGC and ATTTAATTTTCACGGTGAA CAATTTTGCAATCAGC. ::gfp: A CR fragment amplified with primers, TAGTCGACTGTATTGTTC AGACCACTCCCT and ATCCCGGGTCCTGATATCTTCGGACGATTTTCA, was subcloned between SalI and XmaI sites in pd Tissue-specific expression vectors: A CR fragment amplified with primers, TACCCGGGTTCTTAGACACCATACAAAA and TAGGGCCCACAGAGAGCAAA AAGCAATGT, was subcloned between XmaI and ApaI sites in pmf449, pmf451, and pmf435 1 to fuse with the fragment with the promoter of dpy-7, rgef-1, and pgp-1, respectively. Reporter constructs with the nhr-91 3 UTR: The 3 UTR was CR-amplified with primers TAGCTAGCTAGTCTTCCCCAATACCCTCAATACAGC and TAGGGCCC CGTGAGTTGCACGATTATCACATTAG. Mutations in 3 UTR of nhr-91 were introduced by the CR-based method using CGGTTGTAAAATATAATTTA, AGAA ATAAAGCTGTATTGAG and GAATAATTTGTGTAAAATTC, CAGAAATTCAC AACTTGAAG. pest sequence was amplified from pd2egf-1 (Clonetech) using primers ACATGGCATGGATGAACTATACAAAAGCCATGGCTTCCCGCCGGAG GT and TAGCTAGCCACATTGATCCTAGCAGAAGCAC, and subsequently fused with gfp sequence by the CR-based method to prepare gfp-pest. This gfp-pest fragment was subcloned between XmaI and NheI sites in pmf449. Finally its unc-54 3 UTR was replaced with WT and mutated nhr-91 3 UTR, respectively. nhr-91::gfp-pest::nhr-91 3 UTR: DNA fragments amplified by CR using primers described below were combined using restriction digestion, and subcloned into pmf491 vector. The 6.4 kb fragment of the nhr-91 promoter was constructed by combining three DNA fragments which were CR-amplified using 3 pairs of primers (TATCTGCAGATTGTCGTCAGAATGTAGCAGGGGA and CACGACGGCCTAC AACTCACTTTGT, CCATCGTTCTTCATCCGTCCTTCAC and GCTATCGACCAG ACTTTTTCAACTAG, CCTGGTTACTGGATCAGCGATGTAGC and TATCCCGG GCGCACTGAAAGAGGCTCATTAATCAGAGG). The gfp-pest and nhr-91 3 UTR were CR-amplified using primers, GCTAGCCACATTGATCCTAGCAGAAGCACA 2

3 SULEMENTARY INFORMATION GGCGG and GATCCCGGGATGAGTAAAGGAGAAGAAC, and TAGCTAGCTAG TCTTCCCCAATACCCTCAATACAGC and TAGGGCCCCGTGAGTTGCACGATT ATCACATTAG, respectively. dpy-7::qf::sl2::mcherry::unc-54 3 UTR: The XmaI-ApaI fragment derived from XW08 2 was subcloned into pmf449 (see above). hlh-3-enhancer-pes-10::qs::sl2::mcherry::unc-54 3 UTR: The AgeI::QS::SL2:: mcherry::unc-54 3 UTR::ApaI fragment was first constructed by using primers ATACCGGTATGAACACCATCCCGGCACGCCATG and ATGGGCCCGTACGGC CGACTAGTAGGAAACAGT and plasmid XW09 2, and then subcloned into pmf677.2, which harbours ~600bp partial hlh-3 promoter fused to the pes-10 minimal promoter 3. This hlh-3::pes-10 hybrid promoter is active in neuroblasts (as the 3.4kb promoter 4 ), and other non-hypodermal cells during L1 diapause (Fukuyama unpublished data). QUAS:: : The fragment used to construct the tissue-specific expression vectors (see above) was cloned between XmaI-ApaI sites in XW12 2. ztf-16::gfp: The glial enhancer of the ztf-16 5 was CR-amplified by using primers TAGCTAGCGCATGCACCCCCGTTTTTGATTCCCTTTTT and TACCCGGGCGA CATACGTCCTCTCATCAAGAACCTTGG. The enhancer was excised by NheI and XmaI, and subcloned into pmf449 to make ztf-16::gfp::unc-54 3 UTR. ztf-16:: was constructed by replacing the dpy-7 promoter in the dpy-7:: plasmid (see above) with that of ztf

4 SULEMENTARY INFORMATION Starvation Feeding IIS pathway IIS pathway Glia (AmsoL/R) nhr-91 Quiescent Mesoblast Quiescent Glia (AmsoL/R) nhr-91 Reactivated Mesoblast Reactivated Neuroblasts Neuroblasts Hypodermis Hypodermis Supplementary Figure 1 Model for regulation of blast cell quiescence by. is expressed in the hypodermis and amphid socket glia (Amso/LR), which includes neuroblasts. Left: During periods of starvation, expression of stays relatively high, silencing its target genes including nhr-91 in the hypodermis and amphid socket glia. Right: Upon feeding, activation of the insulin/igf signaling (IIS) pathway downregulates. This derepresses expression of nhr-91, which promotes reactivation of neuroblasts and mesoblast. % of larvae that have initiated cell migration % of larvae with divided M cell % of larvae without L1 alae (n4504) % of larvae L1 starvation (days) L1 starvation (days) 5 7 Supplementary Figure 2 ercentage of larvae showing indicated phenotypes during 7-day L1 starvation. Both strains carried ayis6 to visualize M cell. The graph indicates the mean ± s.e.m. The data taken after 5-day L1 starvation are used for Fig. 1c. 4

5 SULEMENTARY INFORMATION LG I 0.1kbp T09B4.7 tm4127 n4504 T09B4.8 Supplementary Figure 3 Genomic structure of the locus. The genomic region used for the rescue experiments in Fig. 1c is indicated by the green bar. 5

6 SULEMENTARY INFORMATION a Lateral left Dorsal osterior Anterior Ventral Lateral right Feeding Feeding cells cell descendants b (n4504) VA neuron Starved Fed Starved del-1::gfp unc-4::gfp VB neuron Supplementary Figure 4 Loss of causes neuroblasts to undergo differentiation during L1 diapause. a, Diagrams showing the L1 development in cells in the feeding L1 larva. cells after migration into the ventral code undergo several rounds of cell divisions, and most of resultant descendants differentiate into several types of motor neurons including VA and VB at late L1 stage. b, Micrographs showing starved and fed and starved (n4504) larvae that express GF reporters for differentiated VA (unc-4::gfp) and VB (del-1::gfp) motor neurons 6,7, respectively. Animals were starved in S medium as Fig. 1b. Scale bar; 10 μm. 6

7 SULEMENTARY INFORMATION Embryo L1 Adult Supplementary Figure 5 Expression of ::gfp. Expression of ::gfp in the pretzel embryo, fed L1 larva and adult in the left, middle and right panels, respectively. L2, L3 and L4 larvae showed similar patterns of the expression as L1 larvae and adults (not shown). Bars; 100 μm. 7

8 SULEMENTARY INFORMATION a Non-hypodermal tissue QUAS QUAS GF No expression Hypodermis excluding neuroblasts dpy-7 promoter QF neuroblasts QF QUAS QUAS GF GF dpy-7 promoter hlh-3 promoter QF QS QF QS QUAS QUAS GF No expression b QUAS:: QUAS::GF dpy-7::qf::sl2::mcherry hlh-3::qs::sl2::mcherry Merge V V V Hyp7 V V c 100 % of larvae after 5-day L1 starvation % of larvae that have initated cell migration % of larvae with divided M cell % of larvae without L1 alae Transgenic line romoter Genotype #1 #2 #3 Hypodermis excluding neuroblasts (n4504) Supplementary Figure 6 Hypodermal activity of nonautonomously regulates blast cell quiescence. a, Schematic of the Q system 2 used to express in the hypodermal cells excluding neuroblasts. The transcriptional activator QF binds to QUAS and activates the genes downstream of the site. This expression can be efficiently suppressed by the transcriptional repressor QS. b, hotographs show the ventral side of a starved L1 larvae that carry the extrachromosomal array haroboring the constructs indicated in a. Note that expression of GF, and presumably, is efficiently suppressed in neuroblasts because QS was induced in these cells. Bar; 10 μm. c, Expression of in the hypodermal cells excluding neuroblasts by the Q system can efficiently restore the defects of (n4504) mutant aniamals. The data for and untransformed animals are the same as Fig. 1c. All strains carried ayis6 to visualize M cell. The graph was created using data from three independent experiments, and 35 animals were scored for each experiment. Error bars are s.e.m. 8

9 SULEMENTARY INFORMATION a ztf-16 ::gfp GF DIC Merge b % of larvae 100 % of larvae that have initiated cell migration 80 % of larvae with divided M cell 60 % of larvae without L1 alae Transgenic line romoter Genotype #1 #2 ztf-16 (n4504) Supplementary Figure 7 Expression of by the glial enhancer can resotre the defects of (4504) mutant animals. a, Expression of ztf-16::gfp, in which the glial enhancer in the ztf-16 promoter 5 was fused to gfp cdna, in a starved L1 larvae. A cell body and a process of an amphid socket cell are indicated by the arrow and arrowheads, respectively. Note that the ztf-16 is also active in other three types of glias and a pair of unidentified neurons 5, as well as the gut. Bar; 10 μm. b, ztf-16::gfp and ztf-16:: were co-transformed, and the phenotypes only in animals expressing GF in at least one amphid socket cell were scored. The data for and untransformed animals are the same as Fig. 1c. All strains carried ayis6 to visualize M cell.the graph was created using data from three independent experiments, and animals were scored for each experiment. Error bars are s.e.m. 9

10 SULEMENTARY INFORMATION (nt) 150 (n4504) mir U6 Supplementary Figure 8 Detection of mir-235 by northern blotting. Total RNA was separated by 15 % of denaturing polyacrylamide (urea/tbe) gel, blotted to the membrane, and hybridized using the StarFire probe. Only mature (22 nt), but not precursor (generally ~70 nt) mir-235 was detected in mix-staged. Total RNA prepared from (n4504) animals was used to confirm the specificity of the probe against mir % of larvae Hours of L1 development % of larvae that have initiated cell migration % of larvae with divided M cell Supplementary Figure 9 Timing of exit from quiescence in and M cells. Wild type animals carrying ayis6 were synchronously grown at 25.5 C as described in Methods, and scored at the indicated times. Error bars are s.e.m. 10

11 Survival rate (%) SULEMENTARY INFORMATION (n4504) daf-16(mu86) Starved period (days) Supplementary Figure 10 (n4504) does not affect the survival rate during L1 diapause. L1 larvae of indicated genotypes were starved in M9 medium. The mean ± s.e.m of survival rate was determined from three independent experiments. 50 animals were scored for each experiment. 11

12 Relative expression of pri-mir-235/act-1 SULEMENTARY INFORMATION n.s. n.s. n.s. daf-2(e1370) daf-16(mu86) daf-16(mu86); daf-2(e1370) Supplementary Figure 11 Relative abundance of pri-mir-235 in starved L1 larvae. Relative abundance of pri-mir-235 in larvae of the indicated genotypes after 24-hour L1 diapause was analyzed by qrt-cr (n=3). n.s.;p>0.05 (paired two-tailed Student's t-test). Error bars are s.d. 12

13 SULEMENTARY INFORMATION a Relative expression of nhr-91 mrna (n4504) Hours of L1 development * b Hours of L1 development 0 h 2 h 4 h 6 h 8 h 10 h nhr-91::gfp-pest::nhr-91 3 UTR Supplementary Figure 12 Expression of nhr-91 in fed L1 larvae. a, Relative abundance of nhr-91 transcripts in synchronously grown animals determined by qrt-cr. Error bars are s.d. *p<0.05 (paired two-tailed Student's t-test; n=3). b, Expression of nhr-91::gfp-pest:: nhr-91 3' UTR in fed larvae. Animals were synchronously grown as Fig. 3. Fusion of the EST sequence to the green fluorescent protein results in its destabilization, so that dynamic regulation of the reporter gene can be detected 8. During several hours after released from L1 diapause, expression of nhr-91::gfp-pest::nhr-91 3' UTR was noticeable only in some neurons around the head. However, after 8 to 10 hours of feeding, a burst of its expression was observed in the hypodermis. Bar; 10 µm. 13

14 SULEMENTARY INFORMATION Supplementary References 1 Fukuyama, M. et al. C. elegans AMKs promote survival and arrest germline development during nutrient stress. Biol. Open 1, (12). 2 Wei, X. et al. Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Nat. Methods. 9, (12). 3 Doonan, R. et al. HLH-3 is a C. elegans Achaete/Scute protein required for differentiation of the hermaphrodite-specific motor neurons. Mech. Dev. 125, (08). 4 Seydoux, G. and Fire, A. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development 1, , rocko, C. et al. Sensory organ remodeling in Caenorhabditis elegans requires the zinc-finger protein ZTF-16. Genetics 190, (12). 6 Winnier, A. R. et al. UNC-4/UNC-37-dependent repression of motor neuron-specific genes controls synaptic choice in Caenorhabditis elegans. Genes Dev. 13, (1999). 14

15 SULEMENTARY INFORMATION 7 Lickteig, K. M. et al. Regulation of neurotransmitter vesicles by the homeodomain protein UNC-4 and its transcriptional corepressor UNC-37/groucho in Caenorhabditis elegans cholinergic motor neurons. J. Neurosci. 21, (01). 8 Frand, A. R. et al. Functional genomic analysis of C. elegans molting. los. Biol. 3, (05). 15