Supplementary information.

Transcription

1 Supplementary information. Construction of JMJD3 plasmids and other vectors plasmid, pfksd346, encoding the ORF of human JMJD3 (KI346) was obtained from the Kazusa DN Research Institute, Japan. Sequence verification of the plasmid revealed two coding mutations in the JmjC domain of the gene that impair the enzymatic activity of the protein (gger et al. 27). The JMJD3 ORF was transferred into pabe retroviral vector and the mutations were corrected by substituting the JmjC domain with sequences obtained by PCR-amplification of a partial cdn clone of JMJD3 (C9994, Geneservice Ltd, UK). construct expressing the carboxy-terminal portion of JMJD3 (amino acids ), incorporating the JmjC catalytic domain (CD), was generated by PCRamplification using the full-length construct as template and the following primers (For CTCGGTCCGGGTCGTGGG, Rev TCCGGTTTCGCGCGTGCTGGC). This fragment was then cloned into the pabe retroviral vector. ll JMJD3 constructs were cloned with an N-terminal hemagglutinin (H) tag. Catalytically inactive versions (Mut) of the CD construct and full length proteins were generated by introducing two point mutations in the iron binding domain (H39T/E392G). Retroviral vectors encoding E6, E7, E6+E7, H- RS V2G, RF-CX and constitutively activated MEK have been described (costa et al. 28). RN interference Multiple sirns (QIGEN) and shrns targeting human JMJD3 were tested for their ability to reduce JMJD3 expression. Sequences specifying shrns were cloned in pretrosuper as previously described (Gil et al. 24). The shrn sequences targeting JMJD3 are: shjmjd3- : CCGGCGCTGCCTTCC, shjmjd3-: CGCGGTGCCGGTG, shrn7: GGCGCGGGGCTC, shrn8: GTGTCTCTTGCTCC. Supplementary Figure S. Upregulation of p6 INK4a and loss of H3K27me3 in the INK4a/RF locus upon induction of RS in F-ER:RS cells.. Increased expression of p6 INK4a protein in F-ER:RS cells treated with OHT for, 2, 5 and 7 days. CDK4 was used as a loading control on the immunoblots.. ChIP analyses showing loss of H3K27me3 at the INK4a locus in F-ER:RS cells. Primer sets are the same that in Fig. D. Experiments were repeated 3 times with similar results. C. Relative levels of INK4a, RF, JMJD3 and EZH2 mrns in F-ER:RS cells treated with or without OHT for 7 days. Graphs represent the mean of three independent experiments. Error bars refer to standard deviation. Supplementary Figure S2. Time course of the expression of p6 INK4a, JMJD3 and EZH2 in response to RS induction.

2 -C. Expression of endogenous p6 INK4a (), JMJD3 () and EZH2 (C) following induction of RS in IMR9-ER:RS cells, as detected by immunofluorescence. Imaging and quantification was performed on at least 2 nuclei for each condition. The data are representative of experiments performed with 3 independently derived IMR9-ER:Ras cell lines. D. Representative immunofluorescence images of the data plotted in panels and C. E. Western blot showing EZH2 expression in response to RS activation in IMR9-ER:RS cells. F. qrt-pcr assessment of the relative level of EZH2 mrn in IMR9-ER:RS cells treated with OHT for 7 days normalized to the levels on day. The data are representative of 3 independent experiments. Supplementary Figure S3. ChIP study of the INK4a/RF locus upon induction of RS in IMR9-ER:RS cells. Chromatin IPs showing reduced binding of CX7, MI and SUZ2 and increased binding of RN Pol II and H3K4me3 at the INK4a/RF locus following activation of RS for, 3 or 7 days. Primer sets are the same as in Fig. D. The data are representative of 2 independent experiments. Supplementary Figure S4. UTX does not bind to the INK4a/RF locus.. Chromatin IPs comparing the relative binding of JMJD3, EZH2 and UTX to the indicated positions in the human INK4a/RF locus.. Chromatin IPs comparing the relative binding of Jmjd3, Ezh2 and Utx to the indicated positions in the mouse Ink4a/rf locus. C. ChIP experiment using mouse ES cells and the indicated antibodies showing binding of UTX to the hoxc8 promoter. Note that the UTX antibody did not provide a significant signal in panels. and. Supplementary Figure S5. ShRN-mediated knockdown of JMJD3 reduces the induction of p6 INK4a by RS.. Knockdown of JMJD3 RN in IMR9-ER:RS cells with two shrns different from those used in Fig 2E. Graphs represent the mean of three independent experiments. Error bars refer to standard deviation.. The shrns and corresponding controls were used to infect IMR9-ER:RS cells. fter selection, cells treated with nm OHT for 7 days and levels of p6 INK4a were assessed by immunoblotting. GPDH served as a loading control. C. nalysis of INK4a mrn expression in the same cells by qrt-pcr. Graphs represent the mean of three independent experiments. Error bars refer to standard deviation. Supplementary Figure S6. Ectopic expression of UTX does not induce p6 INK4a. 2

3 . MRT tumor cells were transfected with the indicated plasmids and selected for blasticidin resistance. Expression of the indicated mrns was analyzed by qrt-pcr. Graphs represent the mean of two experiments. Error bars represent standard deviation.. Levels of p6 INK4a in the transfected cells were assessed by immunoblotting. Supplementary Figure S7. Ectopic expression of JMJD3 induces a senescence-like arrest in HDFs.. F cells were infected with a control virus (Vec) or a virus expressing the catalytic domain of JMJD3 (CD). Immunoblotting shows that cells expressing the catalytic domain of JMJD3 (CD) have enhanced expression of p6 INK4a but the levels of p53 remain unchanged. Similar results were observed in IMR9 cells.. Degree of H3K27me3 modification at various locations in the INK4b-RF-INK4a locus in F cells infected with the CD construct. The results are presented as the ratio of H3K27me3 to total H3 as judged by ChIP analyses. Experiments were repeated 3 times with similar results. C. Cells as in Fig 4 were pulsed for 6 h with rdu and the incorporation was quantified by immunofluorescence. D. IMR9 cells were infected with retroviruses expressing the indicated genes. fter selection cells were subjected to immunofluorescence with a monoclonal antibody against p6 INK4a. Expression of JMJD3, CD, or activated RS, but not of mutant CD, causes a senescence phenotype as judged by increased cell size and staining for p6 INK4a. The same cells were used for the experiments shown in Fig. 4-. E. JMJD3, CD and activated RS cause the appearance of SHFs whereas Cbx7 delays senescence in HDFs. With JMJD3 or CD, there appeared to be smaller but higher numbers of SHFs per cell. Imaging and quantification was performed on at least 2 nuclei for each. Quantification is shown in Fig 4. F. IMR9 cells were infected with retroviruses expressing the indicated genes. fter selection,, cells were seeded in cm plates. The plates were fixed -5 days after seeding and stained with crystal violet. G. Cells as in panel F were subjected to a 6 h pulse of rdu. rdu incorporation was quantified by immunofluorescence. H. Immunofluorescence for γh2x indicates that RS causes a DN damage response in IMR9 cells, whereas JMJD3 or p6 INK4a do not. Cells used were the same as in panels F-G. Supplementary Figure S8. The cell arrest induced by JMJD3 is INK4a/pRb dependent. IMR9 cells infected with the indicated vectors were selected and, cells were seeded in cm plates. The plates were fixed -5 days after seeding and stained with crystal violet. The quantification of this experiment is shown in panel.. The ability of JMJD3 to block proliferation of HDFs is bypassed by co-expression of HPV E7 but not by HPV E6. Cell numbers were compared by staining with crystal violet. 3

4 C. F or Leiden fibroblasts (lacking a functional p6 INK4a protein) were infected with the indicated viruses and the levels of p6 INK4a, RS and H-CD were analyzed by immunoblotting. D. The same cells were pulsed with rdu for 6 h and the rdu incorporation was quantified by immunofluorescence. Experiments were repeated 3 times with similar results. Supplementary Figure S9. role for Jmjd3 in regulating senescence in MEFs.. Infection of wildtype MEFs with RS causes upregulation of Jmjd3 and downregulation of Ezh2, as judged by qrt-pcr. Utx is unaffected. Experiment was repeated twice. Error bars represent standard deviation.. Wildtype MEFs (black bars) and p9 rf-/- MEFs (white bars) were infected with the indicated viruses. fter selection, cells were pulsed with rdu and rdu incorporation was quantified by immunofluorescence. Two independent experiments rendered similar results. C. In continually passaged MEFs, there is a steady decline in H3K27me3 at the Ink4a/rf locus accompanied by increased binding of Jmjd3. The analysis was performed with primer set Ps4, corresponding to the Ink4a promoter (Supp Table ). D. Levels of Jmjd3, Utx and Ezh2 mrns during serial passage of MEFs as assessed by qrt-pcr. Two independent experiments rendered similar results. 4

5 Supplementary Table I. Details of oligonucleotide primers used in this study. Primers used for qrt-pcr Target Forward primer Reverse primer Human p6: CGGTCGGGGCCGTCCG GCGCCGTGGGCGCGCGCT Human p6: Hs_CDKN2 SG QuantiTect Primer ssay (2) (QT89964 ) Human RF: CCCTCGTGCTGTGCTCTG CCTGGTCTTCTGGGCGG Human JMJD3: CCTCGTCCCTCCGT GTGCCTGTCGTCCCGTT Human EZH2: TTCGGTGTCCGGTGG GGTGCGTGTCGGGTTT Human GPDH: TGTGCTCGGGTGGTG TCCTTGGGGCCTGTGGGCC Human RPS4: TCCCGCCCTCCTCCT CTGCGGTGCTGTCGGG Mouse rf: GCCGCCCGGTCCT TTGGCGGGCTGCTCGT Mouse p6: GTGTGCTGCGTGCGGG GCGTTCGTCTGCCCGTG Mouse Rps4: GCCGCCCCTGGCCT CCCCTTTTCTTCGGTGCT Taqman probes used for qrt-pcr Target Probe Human JMJD3: Hs _m Human UTX: Hs 2535_m Human EHZ2: Hs 6789_m Human TP: Human RPLP: Human GPDH: Mouse Ezh2: Mm59248_m Mouse Utx: Mm8998_m Mouse Jmjd3: Mm 33268_m Mouse Gapdh: E Primers used for ChIP in human samples Primers Relative Location Forward primer Reverse primer PS INK4: Exon GGCCTGTCGCCGTGTG TGTTTTCGCGTGGTGCC PS2 RF: Exon GTGGGTCCCGTCTGCGTT CCTTTGGCCCGGGTGG PS3 4.5kb downstream RF start site GGGCGTGTGTCCGTTTC TGTCCCTCGTCTTCCC PS4 5kb downstream RF start site GCCTTGCCCTTCCGGTT TGTGTTCGGCCCTTGCC PS5 kb upstream INK4 promoter CTCGCGGTTTCGGC GCCTTGCGTGCCCC PS6.2kb upstream INK4 promoter CCCCGTTCTTTGGCG GTCCGCCCCCG PS7 3' end INK4 exon GGGGTCTGCGCGG TCGGCGCTCCTGTTCC PS8.2kb downstream INK4 exon GCCGGGGGTGGGG CCTTCGTCTTCTCGCTTCG PS.8kb downstream exon 3 TGGGGCCCCTTGCTC TGTGTTGCCGGGTTGGGG PS2 9kb downstream exon 3 GGGGGTGTGTTGGC CCTGTCCTGGGTGCTGC CCND.kb downstream CCND promoter CCGGCTCGGGGGTTTTG TTTCCCTTCGCGCCGGG Primers used for ChIP in mouse samples Primers Relative Location Forward primer Reverse primer Ps Mouse Ink4b (p5): promoter CGTGGGGGGTGGG GGCGGGTGGCTTTTTC Ps2 Mouse rf (p9): promoter GCCGTGGCCGCCCCTTCGC GGGGTCGCTTTCCCCTTCGG Ps3 Mouse rf (p9): Exon TGTGCGCGGGTGGGC TGGGCGTGGGCGTG Ps4 Mouse Ink4a (p6): promoter GTGGGCCCGGCTCGG CTGTTTCCGCCCGCTCTC Ps5 End of exon α CGTTCCCGCTGCGTG GCTCGGTTTCCTTGC Ps6 etween exon 2 and 3 TTCCCGGGCTGTTCCG TTCCCCCCCCTTG Hoxc8 Hoxc8 promoter CCGGGGTCTGGGTTCGC GGCCGCCCCGCTGGC 5

6 Supplementary Table 2. ntibodies used for ChIP ntigen Source Species Cat. no. JMJD3/KDM6 bcam Rabbit ab383 EZH2/KMT6 bcam Rabbit ab3748 Cbx7 Gil Lab/ Walsh Lab Rabbit N/ UTX/KDM6 bcam Rabbit ab36938 SUZ2 bcam Rabbit ab273 MI- bcam Rabbit ab4398 H3K4me3 Millipore mb clone MC H3K27me3 Millipore Rabbit Histone H3 bcam Rabbit b79 RN pol II bcam mb clone 4H8 ab548 UTX Sigma-ldrich Rabbit HP2 6

7 GENESDEV/29/2664/arradas_Fig S Untreated +OHT Days: p6 INK4a CDK4 C Percent H3K27me3/H3 Relative mrn level Untreated +OHT PS2 PS6 PS7 Untreated +OHT INK4a RF JMJD3 EZH2

8 GENESDEV/29/2664/arradas_Fig S2 D C % p6 INK4a positive cells % JMJD3 positive cells p6 INK4a JMJD3 Days Days Days 3 5 JMJD3 EZH2 DPI % EZH2 positive cells EZH Days 7 E Days EZH2 β-actin F Relative mrn level EZH Days

9 GENESDEV/29/2664/arradas_Fig S CX7 Day Day 3 Day 7 PS PS2 PS3 PS4 PS5 PS6 PS7 PS8 PS PS2 CCND MI Day Day 3 Day 7 PS PS2 PS3 PS4 PS5 PS6 PS7 PS8 PS PS2 CCND SUZ2 Day Day 3 Day PS PS2 PS3 PS4 PS5 PS6 PS7 PS8 PS PS2 CCND RN Pol II Day Day 3 Day 7 PS PS2 PS3 PS4 PS5 PS6 PS7 PS8 PS PS2 CCND H3K4me3 Day Day 3 Day 7 PS PS2 PS3 PS4 PS5 PS6 PS7 PS8 PS PS2 CCND

10 GENESDEV/29/2664/arradas_Fig S4 Human INK4b RF INK4a Mouse Ink4b rf Ink4a Primer sets: Primer sets: Day Day 3 Day 7 Position 6 JMJD3 EZH2 UTX Position 7 JMJD3 EZH2 UTX Position 8 JMJD3 EZH2 UTX Vec RS Position 2 Jmjd3 Ezh2 Utx Position 3 Jmjd3 Ezh2 Utx Position 4 Jmjd3 Ezh2 Utx Position 5 Jmjd3 Ezh2 Utx C Rbp5 Jmjd3 sh2l Ig (naïve) Utx 2% Input M hoxc8 promoter

11 GENESDEV/29/2664/arradas_Fig S5 Relative mrn level JMJD3 Vec sh7 sh8 OHT: Vec sh7 sh p6 INK4a GPDH C 4 INK4a Relative mrn level 3 2 OHT: Vec sh7 sh8

12 GENESDEV/29/2664/arradas_Fig S6 Relative mrn level INK4a JMJD3 UTX Vec CD UTX Vec CD UTX p6 INK4a GPDH

13 GENESDEV/29/2664/arradas_Fig S7 Vec CD H-JMJD3 p6 INK4a p53 CDK4 H3K27me3/ Total H Vec CD PS PS2 PS6 PS7 PS8 C % rdu positive cells Vec JMJD3 CD Mut RS Cbx7 D IF: p6 INK4a Vec JMJD3 CD Mut RS Cbx7 E Vec JMJD3 CD F Vec JMJD3 p6 Ink4a RS Cbx7 Mut RS Cbx7 G H Vec JMJD3 RS p6 Ink4a % rdu positive cells Vec JMJD3 RS p6 Cbx7 γh2x DPI

14 GENESDEV/29/2664/arradas_Fig S8 Vec E6 E7 E6+E7 Vec JMJD3 Relative cell numbers Vector JMJD3 Vector E6 E7 E6+E7 C F Leiden D Vec CD RS Vec CD RS.2 p6 INK4a H RS Relative rdu positive cells GPDH Vec CD RS Vec CD RS F Leiden

15 GENESDEV/29/2664/arradas_Fig S9 Relative mrn levels Vec RS Jmjd3 Utx Ezh2 % rdu positive cells Vec JMJD3 RS Wildtype rf -/- C D Relative mrn levels H3K27me3 Jmjd3 Passage Relative mrn levels Utx Jmjd3 Passage Relative mrn levels Ezh2 Passage Passage Passage