Supporting Information

Transcription

1 Supporting Information AbuOdeh et al /pnas SI Materials and Methods List of Antibodies. Antibodies are listed: polyclonal anti antibody (1:500; gift from Kay Huebner, Ohio State University, Columbus, Ohio); phistone H2A.X (S139; 20E3) rabbit mab (9718S; Cell Signaling); PChk2 (T68) rabbit (2661S; Cell Signaling); ATM (ps1981) rabbit mab (2152 1; Cell Signaling); Gout antiatm (A300136A; Cell Signaling); PChk1 (S296) rabbit (2349S; Cell Signaling); Gout antichk1 (A300162A; Cell Signaling); Rb xp (S824; A300767A; ethyl); rabbit anti (A300274A; ethyl); PHistone H3 (S10; D2C8; Alexa647) XP L rabbit mab (Cell Signaling); antiub, clone FK2 (that recognize both mono and polyubiquitin; ; Millipore); antiub, clone FK1 (that mostly recognize polyubiquitin chains; ; Millipore); antiub, Lys63specific, clone HWA4C4, mouse mab ( ; Millipore); rabbit antip73 (A300126A; ethyl); anti mouse mab (C 100 1; CALIOCHEM); antilamin A/ C (N18; Santa Cruz iotechnology); and antimyc HR(9E10) (SC40; Santa Cruz iotechnology). List of Primers Used for Quantitative RTPCR. Gene Direction Primer sequence MAF Forward CCG TCC TCT CCC GAG TTT TTC MAF Reverse ACA CTG GTA AGT ACA CGA TGC T 7 8 Forward TCC TCA GAG TCC CAT CGA TTT 8 9 Reverse CGG CAG TTG AAG TA Forward CAT GAG AAG TAT GAC AAC AGC CT Reverse AGT CCT TCC ACG ATA CCA AAG T UC Forward ATT TGG GTC GCG GTT CTT G UC Reverse TGC CTT GAC ATT CTC GAT GGT Sequences of shrnas Against the Human Gene. shrna lentiviral plasmids (plko.1puro; clone ID: NM_ s1c1; Sigma) were used to deplete expression in MCF7 cells according to standard protocol. Sequence: CCGGGCCAAGAATGTGCCTCTTCATCTCGAG ATGAAGAGGCACATTCTTGGCTTTTTG. A HEK Gy Time (min) LM7 10 Gy Time (min) HSP90 HSP90 fold change fold change Fig. S1. Induction of expression early after DNA damage stimuli. Immunoblot blot analysis of levels in (A) HEK293 and () osteosarcoma LM7 cells after treatment with 10 Gy. A MDA231 EV MDA231 MDA231 WFPA CL3WT CL4HET CL5KO NCS/time(min) ATM patm p 10Gy/min h h h p Fig. S2. Checkpoint activation in manipulated cells after DSs. (A) MDAM231 cells were transduced with LentiEV, Lenti, or Lenti WFPA. Cells were selected, and clones were treated with NCS (200 ng/ml) for the indicated time points. Wholecell lysates were blotted with antibodies against ATM, patm,, p,, and. () Earlypassage MEFs isolated from embryonic day 13.5 embryos were γirradiated for the indicated time points. Cell lysates were then probed with antibodies against, p,, and. AbuOdeh et al. 1of6

2 H2AX H2AX MCF7shEV MCF7shCL3 DAPI H2AX Merge DAPI H2AX Merge C untreated 15min U2OSDREV U2OSDR U2OSDRWFPA U2OSDRK274R 24h 48h Fig. S3. (A and ) Impaired phosphorylation of H2AX in depleted MCF7 cells. (A) Immunoblot analysis of control and depleted MCF7 cells after ionizing radiation treatment for the indicated times. Wholecell lysates were propped with antibodies against, Ser139H2AX, total H2AX, and. () Representative confocal microscopy images of γh2ax foci (red) in control MCF7ShEV and depleted (MCF7Sh) cells after treatment of ionizing radiation at different time points. DAPI staining (blue) was used to stain nuclei. Foci were quantified and are presented in Fig. 3C. (C) Overexpression of in U2OSDRGFP cells. Cells were transduced with the indicated Lentiviral constructs (EV,, WFPA, or K274R), and stable clones were established. Immunoblot analysis showing expression in the different clones. was used as loading control. IR, ionizing radiation. AbuOdeh et al. 2of6

3 GSTWW12 GSTSDR 1h/NCS patm GSTSDR Lysate GSTWW1_WT GSTWW1_MT GSTWW2_WT GSTWW2_MT 500 ng NCS Lysate GSTWW12 patm GST Pull down HSP90 patm Pull down GSTSDR patm GSTWW12 GST Fig. S4. (A) WW1 domain of physically associates with ATM. HEK293 cells were transfected with (Left) GSTWW12 or GSTSDR or (Right) GSTWW1, mutant GSTWW1WFPA (WW1_MT), GSTWW2, or GSTWW2YFPA (GSTWW2_MT). At 24 h, cells were treated with NCS (200 ng/ml) for an additional 1 h. GST pull down was performed for 2 h, and complexes were analyzed by immunoblotting using antibodies against GST, patm, and or HSP90. () GST interacts with ATM (amino acids1,530 2,100) in vitro. (Top) Schematic representation of ATM deletion constructs used in GST pull down as in vitrotranscribed, translated, and 35Slabeled fragments. The 35Slabeled fragments were incubated with bacterial extracts expressing GST followed by washing and electrophoresis. GST alone was used as the negative control. Middle shows the autoradiogram of 35Slabeled ATM fragments pulled down with GST alone or GST. ottom shows the Coomassiestained loading control of inputs and pulled fragments. AbuOdeh et al. 3of6

4 MCF7Control DAPI MDC1 pchk2 MERGE untreated NCS MCF7sh untreated NCS Fig. S5. Impaired activation and recruitment of MDC1 and pchk2 in depleted MCF7 cells. MCF7 and MCF7Sh cells were treated or untreated with NCS (200 ng/ml) for 30 min. Cells were then fixed and stained with antimdc1 (green) and anti pchk2 (red). Nuclei were counterstained with DAPI (blue). Cells were visualized with confocal microscopy. AbuOdeh et al. 4of6

5 C Fig. S6. (A) Nuclear localization of after NCS treatment. MCF7 or HeLa cells were transfected with GFP. Twentyfour hours later, cells were untreated or treated with NCS (200 ng/ml). At the indicated times after NCS treatment, the cells were fixed and visualized with confocal microscopy using 60 objective lens. Nuclei were counterstained with DAPI (blue); bright field is shown in gray. Nuclear GFP was observed in 50 70% of cells. ( and C) ubiquitination after DNA damage. () HEK293 cells transfected with HAUb and peg or pegwfpa plasmids. At 24 h, cells were treated with UV (100 J/m 2 ) or NCS (200 ng/ml) for an additional 1 h. Cells were then subjected to GST pull down, and lysates were blotted against GST () and tubulin. Pulled down complexes were blotted with antigst (), antiha (Ub), antifk1 (recognizing polyubiquitin), antifk2 (recognizing both mono and polyubiquitin), and antik63 polyubiquitin antibodies. (C) HEK293 cells were transfected with vectors encoding GST or GSTK274R and HAUb, HAUbK63WT, or HAUbK48WT (ubiquitin constructs are either K63 only or K48 only, whereas all other lysines are mutated to arginines). At 24 h, cells were treated with NCS for an additional 1 h; (Right) lysates were then subjected to GST pull down, and precipitates were blotted as indicated. AbuOdeh et al. 5of6

6 C MYCNuc MYCNucK274R HAU 200 ng NCS /1h ATM patm GST GSTK274R CHX NCS TIME/hour p Lamin MYC ATM patm p GST HSP90 densitometry Fig. S7. (A) depleted MCF7 cells were transduced with lentiviral vectors expressing EV or K274R mutant and selected with neomycin. The different cells were untreated or treated with NCS (200 ng/ml). Wholecell lysates were prepared at the indicated time points, and immunoblot analysis was performed using specific antibodies against, p,, and. () HEK293 cells were transfected with vectors encoding GST or GST K274R. At 24 h posttransfection, cells were treated with cyclohexamide (CHX; 100 μg/ml) in the presence or absence of NCS (200 ng/ml) for 0, 2, 4, or 6 h. Wholecell lysates were blotted with antibodies as indicated. Densitometry shows levels of GST or GSTK274R relative to HSP90 levels. (C) HEK293 cells were transfected with MycNuc or MycNucK274R. At 24 h, cells were treated with NCS for an additional 1 h. Cells were then lysed and immunoprecipitated with antimyc antibody. (Lower) Precipitates were blotted with antiha, anti patm, and antimyc. (Upper) Input lysates were blotted as indicated. IP, immunoprecipitation. AbuOdeh et al. 6of6