EGF signaling induces behavioral quiescence in C. elegans Cheryl Van Buskirk and Paul W. Sternberg

Transcription

1 EGF signaling induces behavioral quiescence in C. elegans Cheryl Van Buskirk and Paul W. Sternberg LIN-3/EGF [PIP2] PLC-3/PLC-γ LET-23/EGFR SEM-5/GRB-2 LET-6/RAS [IP3] [DAG] LIN-45/RAF ITR-1/IP3R Ovulation UNC-13 TPA-1/ npkcδ/θ MAP Kinase-dependent specification of cell fates Vesicle release (UNC-18, UNC-64, UNC-31) UNC-7 Inhibition of feeding EGL-4 Inhibition of locomotion Supplementary Figure 1. EGF signaling activates multiple pathways in C. elegans. EGF signaling through the Ras-MAPK pathway is required for several cell fate specification events that affect viability, the development of the hermaphrodite vulva, and male spicule formation. Activation of PLC-3 in the adult spermatheca regulates ovulation via the IP3 receptor ITR-1. Shown in bold is the pathway described in this report, in which neuronal LET-23 activation leads to an inhibition of feeding and movement that is dependent on PLC-3, the diacylglycerol-binding proteins UNC-13 and TPA-1, and several genes required for release of synaptic and dense-core vesicles. The gap junction innexin UNC-7 is required for the inhibition of feeding, and the cgmp-dependent protein kinase EGL-4 is required for the inhibition of locomotion.

2 a ATG EGF TM STOP 3.4 kb intron BamHI HindIII 1 kb A B C D 1 bp b D C B A BstXI L1 L2 L3 L4 MfeI c C B A L4 stage d 6 C 5 4 head body whole LIN-3A LIN-3B LIN-3C LIN-3D Supplementary Figure 2. Alternative splicing within the lin-3 gene a, The lin-3 exon structure is shown, with the alternatively spliced region enlarged below. Two alternate exons (shaded) lie between the EGF repeat and the transmembrane domain. Primers used in RT-PCR analysis are indicated by arrows. b, Developmental RT-PCR of lin-3 using primers flanking the alternatively spliced region yields four products, lin-3a, B, C and D, which were sequenced to confirm their identity. cdnas corresponding to three of these isoforms have been isolated (lin-3a and lin-3b, ref. 1; lin-3c, also called LIN-3XL, ref. 2). A lin-3d cdna was constructed by inserting the lin-3d RT-PCR product into the BstXI-MfeI sites of lin-3a. lin-3c and lin-3d are relatively less abundant in later larval stages, though lin-3c can be

3 detected in the dissected heads of late L4 larvae, shown in c, using primers flanking the alternatively spliced region (upper panel) or using a primer within the alternatively spliced region (lower panel). d, All four isoforms can induce vulval fates. Each lin-3 cdna was placed under control of the hsp16-41 promoter, and transgenic lines were established as described in Methods. Animals carrying the hs:lin-3 transgenes were hand-selected at the L2 stage for a 3 min heat shock at 33 C. Adults were then examined at the plate-level for the presence of a multivulva (Muv) phenotype, indicative of excess induction of vulval fates. Each column represents the average of three transgenic lines. Error bars, s.e.m. Heat-shocked control animals do not show the multivulva phenotype (n=83). hs:lin-3d also produces a low percentage of vulvaless animals: 3.3%Vul, average of 3 lines.

4 WT Time (min) let (sy12) Time (min) plc (tm134) Time (min)

5 ALAablated Time (min) Supplementary Figure 3. Velocity plots of animal movement over a 4 hr period surrounding lethargus. Animals were selected for tracking as late L4 larvae and inspected immediately after tracking to ensure they had passed through lethargus. Ten animals of each genotype were recorded. Dots represent centroid velocities over each 2 sec interval.

6 WT plc-3 (tm134) ALAablated Time (min) Supplementary Figure 4. Velocity plots of animal movement over a 4 hr period during the L4 stage. Animals were selected for tracking as early L4 larvae and inspected at the end of tracking to ensure that they were at the mid-late L4 stage. Five animals of each genotype were recorded. Dots represent centroid velocities over each 2 sec interval.

7 SUPPLEMENTARY TABLES Table S1. Ectopic LIN-3/EGF expression causes a physiological growth defect Stage at % Reaching mid-l4 by 48hr AEL at 25 C heat shock hs:vector hs:lin-3c (%Muv) hs:egf no hs () 97 hatching 92 () 24 L (21) nd L (9) nd L () nd Larvae were subjected to a 3 min heat shock at 33 C at the end of each stage shown and mounted as they reached the L4 stage for precise staging and examination of vulval morphology under DIC optics. AEL = after egg lay. The Expression of LIN-3, or the EGF domain of LIN-3, causes a growth defect. The multivulva (Muv) phenotype indicates high LIN-3 levels at the end of the L2 stage. Multiple lines established for each transgene behaved similarly, and each value above derives from a single line. n>15 for each. Table S2. The growth defect is mediated by EGFR but not by Ras or PI3K % Reaching mid-l4 by 6hr AEL at 2 C +hs:lin-3 (n) hs:lin-3 (n) let-23(sy97)/+ 2 (128) 98 (198) let-23(sy97) 46 (11) 1 (13) let-23(sy12)/+ 2 (124) 97 (123) let-23(sy12) 56 (18) 83 (6) sem-5(n1619)/+ 9 (155) 88 (94) sem-5(n1619) 6 (48) 82 (34) let-6(n234)/+ 2 (439) 99 (312) let-6(n234) (41) 1 (14) lin-45(sy96)/+ 8 (516) 98 (384) lin-45(sy96) (129) 99 (1) age-1(mg44)/+ 2 (192) 55 (142) age-1(mg44) (64) 48 (42) Sibling animals with or without the myo-2:gfp-marked hs:lin-3c transgene were raised at 2 C, heat-shocked at 33 C for 3 min at hatching, returned to 2 C, and mounted as they reached the L4 stage for precise staging under DIC optics. The Ras pathway components sem-5/grb-2, let-6/ras, and lin-45/raf do not suppress the growth defect of hs:lin-3, despite these alleles having similar effects on viability and vulval induction to let-23(sy12) 3-6. age-1 encodes the C. elegans ortholog of the PI3K p11 catalytic subunit 7.

8 Table S3. Pharyngeal pumping rates genotype rate (ppm) std. dev. wild-type N let-23(sy97) let-23(sy12) unc-4(e12) let-23(sy1) let-6(n234) plc-3(sy698) plc-3(tm134) itr-1(sa73) itr-1(n2559) pkc-1(ok563) pkc-2(ok328) tpa-1(k53) tpa-1(pk1397) gpa-12(pk322) unc-13(e51) unc-18(e81) unc-64(e246) unc-31(e169ts) deg-3(u662) unc-7(e5) egl-4(ks62) ceh-17(np1) All animals were well-fed, grown at 2 C, and scored as young adults for pharyngeal pumping. ppm = pumps per minute. For each genotype, n=1.

9 Table S4. None of the known DEG-3 neurons mediate the hs:lin-3 feeding defect + hs:lin-3 genotype neurons affected* % pump n WT 13 deg-3(u662) ALM PLM AVM PVM FLP PVD IL1 IL2 PVC AVG (8,9) 96 8 mec-3(e1338) ALM PLM AVM PVM FLP PVD (1) 5 unc-86(e1416) ALM PLM AVM PVM (11) 37 deg-1(u38) IL1 PVC AVG (12) 5 cfi-1(ky651) IL2 PVC (13) 39 *Neurons affected refers only to the subset of neurons that are also affected by deg-3(u662); most mutations cause defects in the differentiation of additional neurons. References are indicated in parentheses. A hs:lin-3 transgene was crossed into each of the mutant strains and selected as described in Methods. Young adult animals were subjected to a 3 min heat shock at 33 C and scored 2hr later for the fraction of animals showing pharyngeal pumping. Where appropriate, movement was also qualitatively scored, and none of the mutants rescued the hs:lin-3 movement defect.

10 SUPPLEMENTARY METHODS Site of action A 4.3 kb let-23 cdna starting from the ATG (nt 78 of NM_63561) to which a consensus Kozak sequence had been added to the 5 end (courtesy of N. Moghal) was used for site of action studies. To generate Pmyo-2:let-23, the let- 23 cdna was subcloned from pbluescript into the KpnI-SpeI sites of ppd3.69. To generate Psnb-1:let-23, the let-23 cdna was first subcloned into the vector ppd49.26 in order to add a 5 intron to the cdna. The SmaI site just upstream of the intron was used to fuse the let-23 cdna to a PCR-amplified snb-1 promoter and the ligation product was then PCR amplified (for all primer sequences, see below). The transgenes were injected into PS533, a let-23(sy12), unc- 4(e12)/mnC1; pha-1(e2123ts) strain carrying the hs:lin-3 array syex723. The Pmyo-2:let-23 construct was injected at 5 ng µl 1 with the coinjection marker unc-54:gfp (1 ng µl 1 ). The Psnb-1:let-23 DNA was injected at 2, 5, or 7 ng µl 1 with the coinjection marker unc-119:yfp (1 ng µl 1 ). These strains were used to test LET-23 site of action with respect to the pumping defect of hs:lin-3. To analyze LET-23 function with respect to the movement defect, we could not use unc-4 as a linked let-23 marker. Instead, we injected the myo-2:gfpbalanced let-23(sy12)/min1 (PS5131) with hsp16-41:lin-3c (1 ng µl 1 ) and myo- 2:dsRED (1 ng µl 1 ), establishing PS5174 (carrying the array syex757), and then injected this with Psnb-1:let-23 DNA (7 ng µl 1 ) and unc-119:yfp (1 ng

11 µl 1 ). The Pver-3:let-23 transgene was generated using the ver-3 regulatory sequences amplified from nt 12,851-15,821 of cosmid F59F3, and the blunt-end PCR product was ligated to the same Sma-cut let-23 cdna used in Psnb-1:let-23 cloning. The Pver-3:let-23 fusion was injected into PS5632, a let-12(sy12)/min1 strain carrying an integrated hs:lin-3c transgene marked with Pmyo-2:dsRED (syis197). This transgene restored the relevant LET-23 activity in L1-L4 larvae, but not in adults, and hence these transgenic animals and corresponding control animals were assayed as mixed stage larvae (for pharyngeal pumping) or as L4 larvae (movement tracking), while all other hs:lin-3 assays were performed on young adults. For plc-3 site of action experiments, a genomic fragment extending from the translational start of plc-3 through the 3 UTR (nt 15,47-21,44 of Z4889) was fused by overlap-extension PCR to the myo-2 and the snb-1 promoters. DNAs were injected into PS561, described above. The Pmyo-2:plc-3 fusion PCR product was injected at 1 ng µl 1 (higher concentrations were lethal) with the coinjection marker unc-122:gfp (1 ng µl 1 ). The Psnb-1:plc-3 fusion PCR product was injected at 13 ng µl 1 with the coinjection marker unc-119:yfp (1 ng µl 1 ). Primer sequences used in the construction of the above fusions are as follows: Psnb-1 forward, CCAAGCTTTTTGCTGAAATCTAGG; Psnb-1 reverse, GCATGCTGCCCGGGCTGTTCCCTGAAATGAAGC; Pver-3 forward, GCAGAAATATCCTCTCTACCCTACC;

12 Pver-3 reverse, GTTCTTGTGCACTGATGTTTCATTC; Pver-3 forward nested, GATGGGTGGCAACTGGTG; let-23 reverse, GGAGAGCAACAAAGATTTATTTATTTA Pmyo-2 forward, CTTGCATGCCTGCAGGTCG; Pmyo-2 reverse, CATGCTGAGCAATCCCGTACCCCGAGG; plc-3 forward(psnb1 fusion), ACAGCCCGGGCAGCATGCAACACGGCTCAC; plc-3 forward(pmyo2 fusion), CGGGATTGCTCAGCATGCAACACGGC; plc-3 reverse, TTTTGGATTTGGAGGAATGCG Neuron ablations L2 stage animals carrying the integrated hs:lin-3c transgene syis197 (PS5628) were mounted on agar pads containing sodium azide and laser ablations were performed as previously described 14. Mock-ablated animals were mounted and recovered similarly. Statistical Analysis One-tail P-values were calculated using InStat software. Means were compared using an unpaired t-test, with Welch s correction in the case of unequal variances. Categorical data were compared using Fisher s exact test. lin-3 RT-PCR For developmental RT-PCR, total RNA was isolated from synchronized N2 populations by the Trizol method (Invitrogen) and cdna was synthesized using

13 AMV reverse transcriptase (Roche). PCR was performed using primers flanking or within the lin-3 alternatively spliced region: lin-3 forward, CTTCTTGCCATTGTCCACAGGG; lin-3 reverse, TCGTCCATTTGGTGTTTTGAGG; lin-3 alt. rev., GCTGATGTTGAAGATTGCACAATTC. For head versus body PCR, ten late L4 N2 animals were hand selected and cut just posterior to the pharynx using 21 gauge syringe needles. Ten late L4 larvae were used as whole-animal controls. Each tissue sample was subjected to RT- PCR as described above. SUPPLEMENTARY REFERENCES 1. Hill, R.J. & Sternberg, P.W. The gene lin-3 encodes an inductive signal for vulval development in C. elegans. Nature 358, (1992). 2. Dutt, A., Canevascini, S., Froehli-Hoier, E. & Hajnal, A. EGF signal propagation during C. elegans vulval development mediated by ROM-1 Rhomboid. PLoS Biol. 2, e334 (24). 3. Clark, S.G., Stern, M.J. & Horvitz, H.R. C. elegans cell-signalling gene sem-5 encodes a protein with SH2 and SH3 domains. Nature 356, (1992). 4. Beitel. G.J., Clark, S.G. & Horvitz, H.R. Caenorhabditis elegans ras gene let- 6 acts as a switch in the pathway of vulval induction. Nature 348, (199). 5. Han, M., Golden, A., Han, Y. & Sternberg, P.W. C. elegans lin-45 raf gene participates in let-6 ras-stimulated vulval differentiation. Nature 363, (1993). 6. Aroian, R.V. & Sternberg, P.W. Multiple functions of let-23, a Caenorhabditis elegans receptor tyrosine kinase gene required for vulval induction. Genetics 128, (1991).

14 7. Morris, J.Z., Tissenbaum, H.A. & Ruvkun, G. A phosphatidylinositol-3-oh kinase family member regulating longevity and diapuase in Caenorhabditis elegans. Nature 382, (1996). 8. Treinin, M. & Chalfie., M. A mutated acetylcholine receptor subunit causes neuronal degenereation in C. elegans. Neuron 14, (1995). 9. Yassin, L., Gillo, B., Kahan, T., Eshel, M. & Treinin, M. Characterization of the deg-3/des-2 receptor: a nicotinic acetylcholine receptor that mutates to cause neuronal degeneration. Mol. Cell. Neurosci. 17, (21). 1. Way, J. C. & Chalfie, M. mec-3, a homeobox-containing gene that specifies differentiation of the touch receptor neurons in C. elegans. Cell 54, 5-16 (1988). 11. Chalfie, M., Horvitz, H.R. & Sulston, J.E. Mutations that lead to reiterations in the cell lineages of Caenorhabditis elegans. Cell 24, (1981). 12. Chalfie, M. & Wolinsky, E. The identification and suppression of inherited neurodegeneration in Caenorhabditis elegans. Nature 345, (199). 13. Shaham, S. & Bargmann, C. I. Control of neuronal subtype identity by the C. elegans ARID protein CFI-1. Genes Dev 16, (22). 14. Bargmann, C. I. & Avery, L. Laser killing of cells in Caenorhabditis elegans. in Methods in Cell Biol. 48, (eds. Shakes, D.C. and Epstein, H.F.) (Academic Press, San Diego, 1995). VIDEO LEGENDS Video 1. Wild-type pharyngeal pumping A 6 sec clip showing a wild-type animal feeding normally 2 hr after heat shock. Contractions of the posterior pharyngeal bulb can be seen, at a rate of ~24 pumps per minute. Video 2. hs:lin-3 inhibits pharyngeal pumping

15 A 6 sec clip of a hs:lin-3 animal, showing no pharyngeal pumping (and little movement) 2 hr after heat shock. Video 3. Wild-type locomotion A 2 sec clip showing a wild type animal moving normally 2 hr after heat shock. This animal was transferred to a plate containing a fresh lawn of OP5 bacteria and allowed to recover from handling for 1 min before recording its locomotion. Video 4. hs:lin-3 severely impairs locomotion A 2 sec clip of a hs:lin-3 animal, 2 hr after heat shock, showing no movement until the end of the recording, when it is seen to back slowly. This animal was transferred to a plate containing a fresh lawn of OP5 bacteria and allowed to recover from handling for 1 min before recording its locomotion. Video 5. hs:lin-3 animals move normally when prodded A 2 sec clip of a hs:lin-3 animal, 2 hr after heat shock. The animal is motionless until prodded on the tail with a platinum wire, at which point it moves normally but briefly.