Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration
|
|
- Charleen Pitts
- 5 years ago
- Views:
Transcription
1 Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration Authors: Jonathan K.H. Tan and Takeshi Watanabe SUPPLEMENTAL INFORMATION Supplemental Tables 1-4 Supplemental Figure 1
2 Table S1. Marker expression profile of neonatal spleen stromal cell subsets n.d., not determined RP FRC MRC RP stroma CA sinusoids CD gp MAdCAM n.d. - CD n.d. - + VE-Cadherin - + n.d. - + VCAM-1 lo hi - n.d. n.d. ICAM-1 + hi n.d. n.d. n.d. MECA n.d. n.d. + PDGFRβ - - n.d. n.d. n.d. F4/80 lo lo + - n.d. CD105 -/ CD n.d. - + CD11b n.d. n.d. - n.d. n.d. FSC hi hi lo lo hi 1
3 Table S2. Primary antibodies used for cell surface marker binding Antibody Alternative Name Clone Conjugate(s) Source Rat anti-cd Rat anti-cd11b M1/70 Alexa Fluor 647 Cy7 Rat anti-cd16/32 Fc Block 2.4G2 93 Rat anti-cd21/35 CR2/CR1 7G6 Rat anti-cd31 CAM Rat anti-cd45 30-F11 APC efluor 780 Rat anti-cd54 ICAM-1 YN1/1.7.4 Rat anti-cd H12 Alexa Fluor 488 Rat anti-cd105 MJ7/18 Rat anti-cd106 VCAM Rat anti-cd140b PDGFRβ APB5 APC Rat anti-cd144 VE-Cadherin 11D4.1 Rat anti-cd201 EPCR ebio1560 Rat anti-cd254 TRANCE IK22/5 Rat anti-b220 RA3-6B2 Alexa Fluor 488 Alexa Fluor 647 Rat anti-er-tr7 ER-TR7 Santa Cruz Rat anti-f4/80 BM8 Rat anti-fdc-m1 FDC-M1 Hamster anti-gp38 Podoplanin ebio8.1.1 AngioBio Co. Rat anti-ly6g 1A8 Rat anti-madcam-1 MECA-367 Alexa Fluor 488 Rat anti-meca-32 MECA-32 Alexa Fluor 488 Rat IgG2 a Isotype ebr2a control Rat IgG2 b Isotype control R35-95 eb149-10h5 A95-1 eb149-10h5 APC FITC Cy7 Santa Cruz 2
4 Table S3. Secondary reagents used for flow cytometry and immunofluorescence staining Antibody Conjugate(s) Source Donkey anti-rat Alexa Fluor 488 Molecular Probes Alexa Fluor 594 Goat anti-hamster Alexa Fluor 594 Molecular Probes Goat anti-rat Alexa Fluor 647 Molecular Probes Streptavidin APC DyLight 488 efluor 450 Cy7 3
5 Table S4. Quantitative real time PCR primer sequences Genes Forward Sequence Reverse Sequence β-actin catccgtaaagacctctatgccaac atggagccaccgatccaca Rank gctggctaccactggaactc gtgcagttggtccaaggttt RankL attcaggtgtccaacccttcc tgctaatgttccacgaaatg Sdf1 gctctgcatcagtgacggta gggcagcctttctcttcttc CXCL13 tcgtgccaaatggttacaaa acaaggatgtgggttgggta TNFα cgatgggttgtaccttgtc cggactccgcaaagtctaag TNFR1 accaagtgccacaaaggaac cacgcactggaagtgtgtc LTa tccactccctcagaagcact agagaagccatgtcggagaa LTBR gccgaggtcacagatgaaat caggacactggtgaagagca PDGFRb ccggaacaaacacaccttct tagctgggggactcaatgtc Ng2 gatccacctcgcatcatctt gttcccgacaggaaaactca RelB ccgtacctggtcatcacagag cagtctcgaagctcgatggc ICAM1 actgcttggggaactggac aggcatggcacacgtatgta Nkx2.5 aaagaccctcgggcggata ccatccgtctcggctttgt Pecam caacagagccagcagtatgaggac ctgcaactattaaggtggcgatga Madcam cctctgctgagccctacatc cttgtggtaggttgccaggt LYVE1 cagcacactagcctggtgtta cgcccatgattctgcatgtaga HOX11 aagaagaagccgcgcacatc ggagtcgtcagaccacggct 4
6 A CD45 - gated cells PDGFRβ B % PDGFRβ **** *** ns Non-treated CD45 - cells PDGFRβ-depleted CD45 - cells CD201-depleted CD45 - cells 0 Figure S1. Cell marker analysis of spleen PDGFRβ + cells. (A) Neonatal spleen stromal tissue was digested into a single-cell suspension and CD45 - gated cells assessed by 2-marker flow cytometry against PDGFRβ expression. Data are representative of three independent experiments. (B) Percent PDGFRβ + cells amongst CD45 - gated neonatal stromal cell preparations magnetically depleted with PDGFRβ or CD201 antibodies. Error bars indicate SEM. *** P<0.0001, ** P<0.001; one-way ANOVA with Tukey s post hoc test. 5