Supplementary information; Mungamuri et al., 2006
|
|
- Primrose Watson
- 5 years ago
- Views:
Transcription
1 Supplementary information; Mungamuri et al., 6 Antibodies used for western blotting: The following antibodies were used for western blotting: antiser473 Akt (#4), antiakt (#97), antiser9 Gsk 3b (#9336), antigsk 3b (#933), antiser6 FKHR (#946), antifkhr (#946), antiser448 mtor (#97), antiser48 mtor (#974), antimtor (#97), antithr389 S6Kinase (#9), antis6kinase (#9), antiser3/36 S6 (#), antis6 (#7), antiser6 4EBP (#94), anti 4EBP (#94), antiser (# 984), antiser (# 987) and antiser39 (# 98). These antibodies were purchased from Cell Signaling Technology and used at : dilution. Other antibodies used were: antinotch (C, sc64r, Santa Cruz, :4), anti (Ab, Oncogene, :), and antiα Tubulin antibody (CP6, Calbiochem, :), antiparp antibody (Ab, Oncogene, :) and antiactin antibody (Ab, Oncogene, :). The following secondary antibodies were used: AntiRabbit IgG (Goat) HRPlabeled (NEF 8; PerkinElmer Life Sciences) and AntiMouse IgG (Goat) HRPlabeled (NEF 8; PerkinElmer Life Sciences). The primers used for RTPCR are as follows. Lamin A/C st transcript, Sence ACTCATCCCAGACAGAGGGTG3 Anti Sence ATTGGACTTGTTGCGCAGC3, Lamin A/C nd transcript, Sence CTTGCTGACTTACCGGTTCCC 3 Anti Sence CAACCACAGTCACTGAGCGC 3, Lamin A/C 3rd transcript, Sence CAAAAAGCGCAAACTGGAGTC 3 Anti Sence GATCTGCCAATTGCCCATG 3,, Sence CCCCTCCTCAGCATCTTATCC3, Anti Sence CAAAGCTGTTCCGTCCCAGTAG3, GAPDH, Sence TTTGTCAAGCTCATTTCCTGG3 and Anti Sence TGATGGTACATGACAAGGTGC3.
2 Figure S; Mungamuri et al., 6 A B Control Adriamycin C % A Control Adriamycin AdLacZ Adriamycin AdNIC Adriamycin % S sirna sirna Lamin A Lamin B Lamin C GAPDH Control Adriamycin sirna sirna Tubulin Figure S A, H46 cells were infected with indicated viruses ( MOI) and 6 hrs later treated with adriamycin (.8 µg/ml). The cells were subjected to flow cytometry 48 hrs later. The proportion of apoptotic (% A) and DNA synthesizing (% S) cells are shown on the left and right panel respectively. Note that while adriamycin continued to inhibit cellular DNA synthesis even in NIC over expressing cells (right panel), it failed to induce apoptosis in AdNIC infected cells (left panel). B, H46 cells were mock transfected or transfected with or sirna. Adriamycin (. µg/ml) was added to lanes 4, and 6 after 48 hrs of sirna transfection. Total RNA was prepared after 96 hrs of the sirna transfection and subjected to RTPCR analysis for, Lamin A/C (three different transcripts) and GAPDH. C, H46 cells were mock transfected or transfected with or sirna. Adriamycin (. µg/ml) was added to lanes 4, and 6 after 48 hrs of sirna transfection. Total cell lysate was prepared after 96 hrs of the sirna transfection and subjected to western blot analysis of and Tubulin proteins.
3 Figure S; Mungamuri et al., 6 A B C D % CAT Conversion GEBCAT Gal4:(4) pcmv Neo pcmv Neo/NIC % CAT Conversion 3 3 GEBCAT Gal4:(4) EA S EA S del 36 3 Lysate Adriamycin AdLacZ Adriamycin AdNIC Adriamycin Cisplatin AdLacZ Cisplatin AdNIC Cisplatin :DNA complex H3 % Viability AdLacZ Ad AdNIC Ad Ad (MOI) Figure S A, SW48 cells were transfected with µg of GEBCAT and where indicated by, GAL4: (4) (. µg), and pcmv Neo vector or pcmv Neo/NIC (NIC expression plasmid; 4 µg). CAT reporter activity 4 hours posttransfection was measured. The average % CAT conversions with SD are shown. B, SW48 cells were transfected with µg of GEBCAT and where indicated by, GAL4: (4) (. µg), and EA S or EA S del 36 (. µg). CAT reporter activity 4 hours posttransfection was measured. The average % CAT conversions with SD are shown. Note that NIC did not inhibit transcription activity of GAL4 DNA binding domain/ activation domain fusion protein (A compare lane with ) suggesting that inhibition by Notch does not involve p3 squelching, as both Notch and has been shown to utilize p3. As expected, adenovirus S EA protein inhibited transcription activity of the fusion protein in a p3dependent manner as its derivative del 36 (p3 nonbinding mutant) failed to inhibit the same (B compare lane and 3 with ) as described before. C, H46 cells were mock infected or infected with either AdLacZ or AdNIC at MOI. After 6 hrs of infection, the cells were treated with Adriamycin (. µg/ml) or Cisplatin ( µg/ml). The nuclear extracts were made 4 hrs after drug addition and used for electrophoretic mobility shift assay with radiolabeled double stranded oligonucleotide containing binding site (top panel). Equal amounts of nuclear extracts of the samples (except lane ) were subjected to western blot analysis for (middle panel) and Histone3 (H3) proteins (bottom panel). Note that induced by chemotherapy bound to DNA several fold less efficiently if the nuclear extracts were made from cells preinfected with AdNIC (C top panel, compare lane 4 with 3 and lane 7 with 6). To measure the nuclear in NIC over expressing cells, we monitored the levels of in nuclear extracts made from AdNIC preinfected cells. Prior expression of notch by AdNIC infection resulted in drastic reduction of nuclear in chemotherapy treated cells (C middle panel, compare lane 4 with 3 and lane 7 with 6). D, H46 cells were infected with either AdLacZ or AdNIC at MOI. After 6 hrs of infection, the cells were reinfected with Ad with increasing MOI as indicated. After 48 hours of Ad virus infection, the proportion of live cells was quantified by MTT assay as described in methods. The absorbance of control cells was considered as %. Note that H46 cells preinfected with AdNIC are significantly resistant to cytotoxicity induced by Ad.
4 Figure S3; Mungamuri et al., 6 A B C % Viability LY94 Wortmannin Rapamycin AdLacZ Ad AdNIC Ad AdLacZ AdNIC Ad Wortmannin NIC S 473 AKT AKT S 448 mtor mtor Tubulin Hrs AdLacZ AdNIC Ad Rapamycin NIC S 473 AKT AKT S 448 mtor S 48 mtor mtor T 389 S6K S6K S 3/36 S6 S6 S 6 4EBP 4EBP Actin Hrs Figure S3 A, H46 cells were infected with AdLacZ or AdNIC ( MOI). After hr of virus infection, LY94, Wortmannin or Rapamycin were added. After 6 hrs of virus infection, the cells were reinfected with Ad ( MOI). At 48 hours Ad virus infection, the proportion of live cells was quantified by MTT assay as described in methods. The absorbance of control cells was considered as %. B, H46 cells were infected with AdNIC at MOI. After hr of virus infection, wortmannin was added at indicated lanes. After 6 hrs of infection, the cells were reinfected with AdLacZ or Ad ( MOI) as indicated. Total cell lysates were prepared at different time points as indicated and subjected to western blot analysis for indicated proteins. C, H46 cells were infected with AdNIC at MOI. After hr of virus infection, rapamycin was added at indicated lanes. After 6 hrs of infection, the cells were reinfected with AdLacZ or Ad ( MOI) as indicated. Total cell lysates were prepared at different time points as indicated and subjected to western blot analysis for indicated proteins.
5 Figure S4; Mungamuri et al., 6 mtor wt mtor rr mtor rr SIDA mtor rr del l S3I S3I D338A S3I HEAT repeat FAT FRB Kinase domain NRD FAT C mtor rr del 9 9 S3I Figure S4 HEAT repeat and Kinase domain of mtor are required for Notch mediated survival signaling. Diagrammatic illustration of wild type mtor and its mutants. mtor rr carries the mutation S3I, which makes it resistant to rapamycin. Other mutants are made in rr background with mtor SIDA carrying D338A, which makes it kinase dead, mtor rr del, which is deleted for the first amino acids and mtor rr del 9, which is deleted for the first 9 amino acids with the resultant loss of first HEAT repeat.
6 Figure S; Mungamuri et al., 6 A Relative Luciferase Units 3 3 HESluc HES ABluc MCF7/c3 3 B Luciferase activity (CPM X ) DMSO MCF7/c3 LY94 Wortmannin Rapamycin pcep4/ Figure S A, MCF7/c3 cells were mock transfected or transfected with µg of HESluc or HES ABluc. Luciferase reporter activity 4 hours posttransfection was measured. B, MCF7/c3 cells were transfected with µg of PG3Luc. After 6 hrs of transfection, LY94 (lane ), Wortmannin (lane 3) or Rapamycin (lane 4) were added. In lane, pcep4/ ( ng) was transfected along with PG3Luc. Luciferase reporter activity 4 hours posttransfection was measured.