PCR Cloning II fusion domains for purification His 6 GST chitin binding protein MBP

Transcription

1 PCR cloning : why secondary amplification? May 26, 2009 secondary amplification amplification of the coding sequence alone or of defined fragments ligation into expression vector insertion of fusion domains or other sequence features PCR Cloning II fusion domains for purification His 6 GST chitin binding protein MBP analytical fusion tags epitope tags: His 6,Flag, HA, c-myc fluorescent tags (GFP) Epitope tags Epitope tags HA His 6 Flag c-myc V 5 YPYDVPDYA HHHHHH DYKDDDDK EQKLISEEDL GKPIPNPLLGLDST Epitope tags PCR cloning : secondary amplification Hemagglutinin HA YPYDVPDYA PCR with template concentrations product yield already in the first cycles cycle count needed linear rather than exponential mode er error propagation neuraminidase hemagglutinin 1

2 PCR cloning : amplification errors PCR cloning : amplification errors cycle no molecules correct error wrong after rel. wrong 30 cycles after 30 cycles , , , , , , , , , , , , , ,1035E ,0518E ,5259E ,6294E ,8147E ,9073E ,5367E ,7684E-07 misamplification after 30 cycles log misamplification after 30 cycles ,3842E ,1921E-07 affected cycle affected cycle ,9605E ,9802E ,4901E ,4506E ,7253E ,8626E-09 PCR cloning : amplification errors PCR cloning : secondary amplification starting molecules cycle secondary amplification features usually no free choice of primer location very sequence background (purified plasmid DNA as template) template concentration may be used insertion of 5 non-annealing sequences ,0486E+10 5 overhanging sequence: Kozak consensus sequence 5 overhanging sequence: restriction sites Kozak consensus sequence GCC GCC ACC ATG G insertion of RE sites into the PCR primers try to find two enzymes that cut in the same buffer that work at the same temperature make sure that there are no internal restriction sites in the amplificate to use different overhangs at the 5 and 3 end of the insert Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283. Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196,

3 5 overhanging sequence: restriction sites Restriction enzymes good restriction enzymes 5 overhanging sequence: restriction sites 5 overhanging sequence: restriction sites bad restriction enzymes blunt cutters most REs don t like DNA ends! adda GC clamp(seesupplier information) methylation-dependent sites, weird reaction temperatures avoid, if possible! example: Calbindin/pGEX-2TK pgex-2tk Primer Sequence TmNN GC Pos Dir Note CCC GGA TCC ATG GCA GAA RS-174 TCC CAC CTG CAG T 59,3 0,55 start sense Clamp / BamH I / seq-spez CCC GAA TTC CTA GTT GTC RS-177 TCC AGC AGA AAG AAT A 51,2 0,4 stop antisense seq-spez / EcoR I / Clamp calbindin coding sequence: ~ 850 bp pgex-2tk is a vector for IPTG-driven expression from E.coli 3

4 example: CB/pGEX-2TK The sense-primer RS-174 CCC GGATCC ATGGCAGAATCCCACCTGCAGT G S M A E S H L Q Clamp BamH I Sequence-specific example: CB/pGEX-2TK The antisense-primer (displayed as reverse-complement!) RS TATTCTTTCTGCTGGAGACAAC TAG GAATTC GGG-5 I L S A D G N. E F Sequence-specific EcoR I Clamp CB Amplification 1. Template a 2. Template b Ligation RS-174/ RS-177 (850 bp) 2.0/50 (x15) Pfu/Taq gel elution (QIAgen) EcoR I/ BamH I restriction digest agarose gel electrophoresis ligation into pgex-2tk ligation efficiency is dependent on DNA concentration ligase concentration temperature buffer viscosity time component concentrations dimer formation circularization DNA concentration ligase concentration buffer viscosity 4

5 1x T4 ligase buffer (NEB) 50 mm Tris-HCl (ph 7.5) 10 mm MgCl2 10 mm dithiothreitol, 1 mm ATP 25 μg/ml bovine serum albumin ligation experiment monomer (900 bp) dimer Unit Definition One Cohesive End Ligation Unit is defined as the amount of enzyme required to give 50% ligation of Hind III digested λ DNA in 30 minutes at 16 C in 20 μl at a 5 termini oncentration of 0.12 μm (300 μg/ml). circularized dimer ligase concentration 100 ng fragment, ligation for 30 min at RT ligation temperature temperature (16 C) temperature (RT) good bad annealing ligase activity ligation time 0.5 µl ligase, 100 ng insert, 100 ng vector, 23 C troubleshooting the ligation reaction optimize ligase concentration choose enzyme concentration that gives maximum amount of dimers optimize vector concentration ligate 15 min at RT, choose sample with maximum amount of dimers recircularize dilute 10 x and add ligase concentration, incubate 4 h or o/n at 16 C incubation time (min) find troubleshooting guide here: 5

6 conclusions incubate at 16 C for difficult ligations, increase ligation time optimize DNA concentration avoid blunt end ligations prefer asymmetric ligations always include a vector religation control CB Amplification 1. Template a 2. Template b RS-174/ RS-177 (850 bp) 2.0/50 (x15) Pfu/Taq gel elution (QIAgen) EcoR I/ BamH I restriction digest agarose gel electrophoresis ligation into pgex-2tk CB/pGEX-2TK colony-pcr 1. Template a 2. Template b RS-176/ RS-160 (318 bp) 2.0/50 (x25) Pfu/Taq CB protein expression 1. CB (1:10) 2. CB-biotin (1:10) 3. CB (1:1) 4. CB-biotin (1:1) Ponceau stain Avidin-POD stain 6