iclip protocol Balaji Sundararaman, April (Adapted from Ule s and Amy s lab protocols)

Transcription

1 iclip protocol Balaji Sundararaman, April (Adapted from Ule s and Amy s lab protocols) Day 0: Cell crosslinking For K562 cells: 1. Spin the cells, wash with PBS and count. 2. Resuspend ten million cells in 5ml PBS and pipette in to a new 10cm dish. 3. Place the dish on a bed of ice, level the plate on ice such that the cell suspension is evenly spread. 4. While keeping the dish on bed of ice, take OFF the lid, and irradiate with UV. 5. Use 400mJ/cm 2 constant energy to crosslink. 6. Scrap off the cells and collect by washing with PBS. 7. Pellet cells by spinning at 500g for 10 min at 4C. 8. Discard excess PBS and resuspend the pellet in 1ml cold PBS, transfer to RNAase free epi tube. 9. Quick spin the epi at 15000g for a min to pellet the cells, discard about 900µL of PBS and leave 100µL with the pellet. 10. Snap freeze the pellet in liquid nitrogen or on ethanol-dry ice bath. Store cell pellet at -80C. Day 1: Part I Lysis and RNA trimming (Use RNA grade supplies) 1. Thaw cell pellet on ice. 2. Resuspend pellet (with appropriate protein yield of 1mg) in1ml Lysis buffer (50 mm Tris-HCl, ph 7.4; 100 mm NaCl; 1% NP-40; 0.1% SDS; 0.5% sodium deoxycholate) with protease inhibitor (Roche cocktail). 3. Leave tubes in ice for 15 min for complete cell lysis. 4. Dilute RNase I 100U/ul (AM2295) in RNase Dilution buffer (10mM Tris-HCl ph 8.0, 100mM NaCl, 50% Glycerol). a. 1/500 RNase I dilution (Low RNase) is used for library preparation, while 1/50 dilution (High RNase) is used to control for antibody specificity. 5. Add 10ul of diluted RNase I (final total RNase concentration is 40U for High and 2U for Low RNase conditions) and 2ul of Turbo DNase. Keep tubes on ice while mixing. 6. Incubate exactly 3 min at 37C/1200rpm in Thermomixer. 7. Keep the tubes in ice for 3min. 8. Spin at 20000g/20min/4C. Save the clear supernatant in new tube in ice for IP. Discard the pellet. Part II: Immunoprecipitation (Use RNA grade supplies) 1. Wash 1.25mg per tube per RNase dilution, of Dynabeads (Protein A, G or secondary Ab coated beads of choice) twice with 1ml cold Lysis buffer. 2. Resuspend beads in 250ul of Lysis buffer. 3. Use 50ul to preclear the lysate saved in ice at step 7, part I above. Rotate bead+lysate for 30min/RT. 4. With remaining 200ul of beads, add 10ug of antibody specific for protein of interest (POI). Rotate bead+ab for at least 1hr/RT.

2 5. After 30min of preclearing, keep the tube on magnetic stand. Transfer clear lysate to new tube and save in ice. Save 20ul of precleared lysate as Input sample for WB later. 6. After 1hr of Ab+bead binding, remove excess ab, wash beads thrice with 1ml cold lysis buffer. 7. Add precleared lysate saved in step 5 with the washed beads. 8. Rotate at 4C overnight. Day 2: Dephosphorylation and 3 RNA Adapter ligation 1. Keep the tubes in magnetic rack and remove the supernatant. 2. Save 20ul of supernatant as IP-sup sample for WB later, discard the rest. 3. Wash beads twice with 900ul cold High salt wash buffer (50 mm Tris-HCl ph 7.4, 1 M NaCl, 1 mm EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate). 4. Wash beads twice with 900ul cold Wash buffer (20 mm Tris-HCl ph 7.4, 10 mm MgCl2, 0.2% Tween-20) 5. Resuspend beads in PNKpH 6.5 mix: ddh2o 15µL 5X PNK ph 6.5 Buffer 4.0µL PNK Enzyme (NEB) 0.5µL RNaseOut 0.5µL TOTAL 20µL Note: 5X PNK ph 6.5 buffer (350mM Tris-HCl, ph 6.5; 50mM MgCl 2 ; 25mM DTT) is homemade and NOT the PNK buffer supplied by NEB. At ph 6.5, PNK enzyme has 3 dephosphorylation acitivity. 6. Incubate at 37C/20min/1200rpm (for 15sec in 5min interval). 7. Add 500ul of Wash buffer, mix and remove. 8. Wash with cold 900ul High salt wash buffer. 9. Wash twice with cold 900ul Wash buffer. 10. Resuspend in Ligation mix: ddh2o 9.0uL 4X Ligation Buffer 4.0µL T4 RNA Ligase 1 1.0µL RNaseOut 0.5µL 20µM L3 1.5µL PEG µL TOTAL 20µL Note: Homemade 4X ligation buffer (200mM Tris-HCl ph 7.4, 40mM MgCl2, 40mM DTT) 11. Incubate at 16C/Overnight/1200rpm (for 15sec in 5min interval).

3 Day 3: End labeling, SDS-PAGE and transfer 1. With 3 RNA Linker ligation mix incubated O/N, add 500ul of wash buffer. 2. Keep the epi on magnetic stand, remove and discard the buffer. 3. Wash twice with 900ul cold High salt wash buffer. 4. Wash twice with 900ul cold Wash buffer. 5. Resuspend beads in 200ul wash buffer 6. Save 20ul of resuspended beads as On bead Sample for WB. ** Here after the protocol becomes hot be aware of radioactivity and take precautionary steps** 7. Remove buffer from the remaining 180ul and resuspend beads in Hot PNK mix immediately as below. 10X PNK buffer (NEB) 8µL P 32 -γ-atp 1µL T4 PNK enzyme (NEB) 4µL ddh2o 67µL TOTAL 80µL 8. Incubate at 37C/10min/1200rpm (for 15sec in 2min 45sec interval). 9. Add 500ul cold wash buffer, wash and discard buffer. 10. Wash one more time with 500ul cold wash buffer. 11. Resuspend in 30ul wash buffer + 10ul 4X NuPAGE SDS buffer + 2ul 1M DTT. 12. Denature sample by boiling at 70C/10min/1200 rpm (shaking continuously). 13. Denature Input, IP-Sup, On bead samples saved from above steps as well. 14. After boiling, place the samples immediately on ice cold magnetic stand, remove the sup for loading. 15. Load samples on appropriate denaturing gel (4-12% BT or 8% TG depending upon the WM of POI). 16. Split and load hot samples in two wells to avoid any overflow and if number of wells permits, leave one empty well between samples. I prefer 10 well, 1.5mm thick gel for its broad and spacious wells. 17. Also load IP samples (Input, IP-sup and on bead samples) in a separate gel. (Use same kind of gel ie gel %, thickness and buffer. Number of wells can be changed to accommodate more samples for WB). 18. Load Spectra Broad or High range MW marker depending upon size of POI. 19. Preferably run both HOT and COLD gels together in same buffer tank. 20. Run at 180V for 1.15hr or as desired using MOPS running buffer. 21. Transfer the protein-rna complexes to nitrocellulose membrane (0.45µm pore size) using NuPAGE transfer buffer with 10% methanol and 0.01% SDS. 22. Transfer at 200mA constant current for 2hr in ice bath. 23. After the transfer, rinse the HOT membrane in 1X PBS buffer, wrap it in saranwrap and expose to autoradiography film (15min, 1hr, and overnight exposures). There must be some difference in the band intensity and pattern between low and high RNase treatments. 24. Check the transfer efficiency of COLD membrane by Ponceau stain and block with 5% milk. 25. Leave the COLD membrane in primary antibody (same antibody used for IP) overnight at 4C.

4 Day 4: WB completion and hot RNA isolation 1. Wash the COLD membrane and incubate for 1-3hr at room temperature with appropriate secondary HRP antibody (TruBlot HRP if same primary used for IP and WB). 2. Develop the COLD membrane with ECL or ECL+ substrate depending on the abundance of the POI. Note: If there is time constraint on completing the WB of the COLD membrane, the HOT membrane can be stored for about a week at 4C inside the cassette or plexi box. 3. Overlay autoradiography films developed from the HOT and COLD membranes to match the protein band in WB and RNA smear in the HOT membrane. 4. Cut band pattern in the 15min exposure autoradiography film of HOT membrane based on the MW/band pattern overlay as above to guide cutting the actual HOT membrane. Scan the film before cutting. 5. Place the film with holes and overlay the marker bands with the actual HOT membrane and cut the membrane between 65-80kDa as one slice and between 80kDa to just below 225kDa as another piece and keep them in separate tubes. Cut bands from both high and low RNase treatment lanes. At later steps, high RNase bands might fail to produce library. 6. By now there should be four membrane pieces two for at and above the MW of POI from two different RNase treatments. Slice the membrane to smaller fragments. 7. 1:5 dilute the NEB Proteinase K (20mg/ml) to final concentration of 4mg/ml in 1X PK buffer (100mM Tris- HCl ph 7.4, 50mM NaCl, 10mM EDTA). Use RNase free one, so doesn t have to preincubate at 37C to kill RNase. 8. Add 200ul of 4mg/ml Proteinase K to the membrane pieces and incubate at 37C/20min/1200rpm (continuous shaking). 9. Make fresh 7M Urea/PK buffer. Dissolve 420mg of RNA grade Urea in 500ul of 1X PK buffer and make up the volume to 1ml in PK buffer. 10. Add 200ul of 7M Urea/PK buffer to the above proteinase K treated tubes. No need to remove proteinase K, add urea buffer together in the same tube. Incubate at 37C/20min/1200rpm (continuous shaking). 11. Add 500ul of acid phenol-chloroform mix (RNA grade from Ambion) to the tubes. No need to remove nitrocellulose membrane pieces. Incubate at 37C/20min/1200rpm (continuous shaking). 12. Vortex briefly and spin tubes at 13000g for 15min. 13. Transfer the aqueous layer to new tube, add 400ul Chloroform, vortex briefly and spin at 13000g for 15min. 14. Transfer the aqueous layer to new tube, add 1ul Glycogen, 30ul 3M NaOAc ph 5.5, vortex and brief spin. 15. Add 1ml of 100% ethanol, vortex briefly to mix and precipitate overnight at -80C. Store tubes in plexi box. Day 5: Reverse transcription 1. Spin the ethanol precipitated hot RNA at 13000g/20min/4C. 2. Wash pellet twice with 500ul 75% EtOH. Count radioactivity to check precipitation. 3. Air dry pellet for 5-8min. Check counts to make sure the presence of pellet. 4. Resuspend pellet in dntp/primer mix as below. Vortex to dissolve pellet and spin.

5 ddh2o 6.25µL Rclip primer (0.5pmol/µL) 0.50µL 10mM dntp 0.50µL TOTAL 7.25µL Note: Rclip primers are barcoded, use different indices for each experiment/treatment. 5. Denature at 70C/5min in PCR theromixer. Snap cool the tubes on ice. 6. Add the RT-enzyme mix to the cooled RNA/primer/dNTP mix as below, 5X First-strand RT Buffer 2.00µL 0.1M DTT 0.50µL Superscript III 0.25µL TOTAL 2.75µL 7. Vortex to mix the RT reaction contents and brief spin. 8. Transfer the RT reaction (must be 10ul) to new 0.2ml PCR tubes, spin. 9. Run RT reaction in PCR machine as below, 25C/5min - 42C/20min 50C/40min 80C/5min 4C/ 10. After the RT reaction, add 100ul H2O, 1ul Glycogen mix to PCR tubes, then add 10ul 3M NaOAc, ph Vortex, spin and transfer (~120ul) to new 1.5ml tube. 12. Add 300ul 100% EtOH, vortex and precipitate overnight at -80C. Store in plexi box as tube might have residual count. Day 6: cdna size selection 1. Spin EtOH precipitated cdna at 13000g/20min/4C. Wash pellet with 500µL 75% EtOH. 2. Dry pellet for 5-7min. 3. Resuspend pellet in 10µL of H2O, vortex, spin and leave 5-7min at RT. 4. Add 10ul 2xTBE-urea loading buffer, vortex and spin. 5. Heat denature sample at 80C/3min in PCR machine and snap cool in ice. 6. Run in 6% Urea-TBE gel along with 25bp ladder using 1X TBE run buffer at 100V for 50-60min. 7. Run until the bromophenol blue dye is at 4/5 th of the gel length. 8. Stain gel with SYBR-Gold for 5-10min. 9. Band or smear pattern may not be visible because of low amount of cdna. 10. Using ladder and dye front as guide (Xylene cyanol runs at 110nt in 6% TBE Urea gel), cut three bands as below, a. Low (70-85nt) just below 75bp to just above 75bp b. Medium (85-120nt) just above 75bp to just below 125bp (the darker band in the ladder) c. High ( nt) just below 125bp to at 200bp (3 rd band above the darker band in the ladder) ** After this step, tube will not have any counts can be moved to regular bench and considered as NOT hot **

6 ** After this step, tube will not have any counts can be moved to regular bench and considered as NOT hot ** 11. Place the gel piece in 0.5ml tube which has 2-3 holes poked in the bottom. 12. Place this tube in a 1.5ml tube and spin at 13000g/15min/RT. This will smash the gel into tiny pieces. 13. Remove the empty 0.5ml tube and with the gel slurry add 300ul PAGE gel elution buffer (300mM NaCl, 10mM Tris ph 8.0, 1mM EDTA). 14. Rotate the tube overnight at 4C. Day 7: cdna precipitation 1. Mix the gel slurry/ buffer mix and transfer to SpinX column fitted with 0.45um filter (Coaster). 2. Spin the SpinX tube with the lid open at 13000g/10min/RT. 3. Transfer the clear buffer with eluted cdna to new tube, add 1ul glycogen, 50ul 3M NaOAc ph 5.5, vortex and brief spin. 4. Add 1ml 100% EtOH, vortex and precipitate overnight at -80C. Day 8: Circularization and Linearization of cdna 1. Spin at 13000g/15min/4C to precipitate cdna. Wash pellet twice with 75% EtOH. 2. Dry the pellete at RT for 5-10min. 3. Resuspend the pellet in 5ul H2O. Vortex, brief spin and leave at RT for 5-7min. 4. With the resuspended cdna add the CircLigase mix as below, ddh2o 10X CircLigase Buffer II 50mM MnCl 2 CircLigase II Enzyme TOTAL 1.5µL 0.8µL 0.4µL 0.3µL 3.0µL 6. Vortex, brief spin and transfer the total 8ul reaction to new PCR tube. 7. Incubate at 60C/1hr 80C/10min in PCR machine. 8. After incubation, add the following Cut Oligo mix, ddh2o 26µL 10X Fast Digest buffer 3µL 10µM Cut_oligo_ddc 1µL TOTAL 30µL 9. Transfer the annealing mix to epi tube, vortex and spin. 10. Incubate in thermomixer at 95C/1min. 11. While the tube still in the mixer, change the temperature to 25C. The change in temperature takes about 25min which is equivalent for decreasing 1C for every 20sec. This denaturation followed by slow temperature decrease anneals the oligo with the sscdna. 12. After tubes reached 25C, add 2ul of Fermentas FD BamHI, vortex and spin.

7 13. Incubate at 37C/30min. 14. After incubation, add 50ul TE, 1ul glycogen, mix and spin. Then add 10ul of 3M NaOAc ph5.5, vortex then add 250ul of 100% EtOH, vortex and precipitate at -80C overnight. Day 9: Final library amplification 1. Spin at 13000g/15min/4C to precipitate the end ligated-bamhi cut cdna. 2. Wash twice with 500ul 70% EtOH. Air dry the pellet for 5-7min. 3. Resuspend in 19ul H2O. Vortex, spin and leave at RT for 5-10min. 4. Transfer the resuspended cdna to new PCR tubes and add the following PCR reactions, ddh2o 9.0µL Final concentration 5X Phusion buffer 8.0µL 10mM dntp mix 1.0µL 0.25mM 10uM P5 solexa primer 1.0µL 0.25uM 10uM P3 solexa primer 1.0µL 0.25uM Pusion Taq 1.0µL cdna 19.0µL TOTAL 40.0µL 5. Run the PCR reaction as below, 94C/2min (94C/15sec 65C/30sec 68C/30sec) x 25 cycles 68C/3min 4C/ 6. Run the PCR products on 8% TBE gel at 100V/50-60min. 7. Stain with SYBR Gold and size select the final library. 8. Perform overnight gel elution and precipitation as described above (Day 10 & 11). 9. Validate the library in TapeStation or quantitate using PicoGreen (Day 11). 10. Normalize and pool indexed libraries for sequencing, sequence libraries from different cdna sizes separately (H, M, L).

8 Appendix: Linker, Adapter and Primer sequences: L3, 100nmol HPLC Purified, IDT: /5rApp/AGATCGGAAGAGCGGTTCAG/3ddc/ Rclip Reverse Transcriptase Primers with Different Bar Codes: Standard Desalting IDT Rclip01: /5phos/NNAACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip02: /5phos/NNACAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip03: /5phos/NNATTGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip04: /5phos/NNAGGTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip05: /5phos/NNCGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip06: /5phos/NNCCGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip07: /5phos/NNCTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip08: /5phos/NNCATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip09: /5phos/NNGCCANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip10: /5phos/NNGACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip11: /5phos/NNGGTTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip12: /5phos/NNGTGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip13: /5phos/NNTCCGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip14: /5phos/NNTGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip15: /5phos/NNTATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rclip16: /5phos/NNTTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Cut_oligo_ddc: GTTCAGGATCCACGACGCTCTTC/3ddc/ P5Solexa (Paired End PCR Primer 1.0 Illumina), PAGE Purified, IDT: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT P3Solexa (Paired End PCR Primer 2.0 Illumina), PAGE Purified, IDT: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT