Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes

Transcription

1 Supplemental Material for Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes Dong-ki Lee, Soyoun Kim, and John T. Lis Due to be published as a Research Communication in Genes and Development Polymerase recruitment to the gene upon copper induction in srb4-ts mutant: run-on assays. Previous assays of accumulated mrna did not distinguish between de novo mrna synthesis and mrna stabilization (Lee and Lis, 1998; McNeil et al. 1998). To examine if new Pol II molecules are recruited to the promoter in the absence of functional Srb4, we used a runon transcription assay. The run-on transcription assay measures the density of transcriptionallyengaged polymerases on a specific gene fragment, allowing one to monitor changes in transcription more directly than examining the accumulation of mrna by Northern blot or S1 nuclease assays. We examined the endogenous gene, a -LacZ reporter, and the gene as a control. Figure 1 shows that the Pol II density on the gene is strikingly less in the srb4 ts mutant than in wild type at the nonpermissive temperature. However, polymerase density on both and -LacZ genes increased similarly upon copper addition in the srb4 ts mutant and wild type. Therefore, we conclude that the Srb4-independent increase in mrna occurs at a step that leads to an increase in the density of transcription complexes on the gene. Our run-on results agree with McNeil et al (1998) and extend their studies to provide a direct measurement of the recruitment of Pol II on gene after copper induction. It should be noted that while the ratio between uninduced and induced gene transcription was similar in the SRB4 wild type and mutant, the uninduced level of mrna was 2-3 fold less in the srb4 ts mutant even at the permissive temperature. This lowered, uninduced level of mrna in the srb4 ts mutant, may be why the gene was not identified as a Srb4- independent gene in another study (Holstege et al., 1998). The lowered basal level may be explained if 1) basal level transcription is partially dependent upon functional Srb4, and is affected by the partially crippled Srb4ts protein at the permissive temperature or 2) the partially crippled Srb4 ts protein affects the transcription of other genes at the permissive temperature, and this in turn affects the basal transcription of. We favor the second idea that the decrease in the basal level of mrna in srb4 ts is a secondary effect, because the temperature shift to inactivate Srb4 did not further reduce the mrna level (data not shown). In either case, it is clear that the gene is normally inducible in yeast with a defective Srb4 protein.

2 SRB4 RT 37 o C -Cu +Cu srb4 ts RT 37 o C -Cu +Cu LacZ3 LacZ Fold induction SRB4 srb4 ts LacZ3 LacZ Supplementary Figure 1. Run-on transcription assays of yeast with and without a 5 minute induction with 1mM copper sulfate (Cu). Inductions were performed after cells had been shifted to 37 C for 1.5 hr. The (entire gene) and -LacZ signals (5'and 3' halves of the lacz transcription unit) were exposed 2.5 times longer in the run on assay with the srb4 ts mutant to allow the fold induction in the isogenic SRB4 and srb4 ts mutant to be directly compared.

3 Mediator independence is specified by the UAS region of the promoter The molecular basis for the Srb4-independent transcription must be specified by features of the promoter. By testing a series of hybrid promoters that contain the UAS from the Srb4- independent gene and the core promoter from an Srb4-dependent gene ( and ), and vice versa, we determined that Srb4-independent transcription is specified by the UAS, not by the core promoter (Supplementary Fig.2). The same conclusion was derived independently with a different set of hybrid promoters by McNeil et al. (1998). Materials and Methods Construction of strains and plasmids. Promoter hybrid constructs were generated as follows. The UAS of, and genes were PCR amplified and digested with KpnI- BamHI. Core promoter of same genes were also PCR amplified and digested with BamHI- HindIII. Combination of UAS and core DNA fragments were three-piece ligated with KpnI- HindIII digested YEp356 vector to generate each promoter hybrid. PCR primers to amplify the UAS and core of each gene, and the location of each UAS and core relative to the translation initiation site are as follows: CUP UAS up: 5 -GGGGTAC CCGTTAGTGAACTGAACAG-3 CUP UAS dp: 5 -CGGGATCCC ATATTGCGTTGGTAGTC-3 ; -653 to 177 of the promoter. ADH UAS up: 5 -GGGGTACCGGGGGTAACACCCCTCCG-3 ADH UAS dp: 5 -CGGGATCCATGGTGAGACAACAACGG-3 ; -778 to 357 of the promoter. UAS up: 5'-GGGGTACCGCTCATTGCTATATTGAAG-3' UAS dp: 5'-CGGGATCCCTAATCGCATTAT CATCC-3'; -474 to 210 of the promoter. core up: 5 -CGGGATCCTATGGATTGT CAGAATC-3 core dp: 5 -GATCGCAAGCTTGCATTTTATGTGATGATTGATTG-3 ; -161 to +1 of the promoter. core up: 5'-CGGGATCCTTTGCTGTCTTGCTATCAAG-3' core dp: 5'-GATCGCAAGCTTGCATTGTATATGAGATAGTTG-3'; -149 to +1 of the promoter. core up: 5'-CGGGATCCCAGCGAAGCGATGATTTTTG-3' core dp: 5'-GATCGCAAGCTTGCATTATAGTTTTTTCTCCTTGACG-3'; -180 to +1 of the promoter. The HSEM construct, which is a 2 micron-based -LacZ reporter with a point mutation in the heat shock element within the promoter, is a gift from Dennis Thiele (Tamai et al., 1994). Plasmids for run-on transcription experiments were generated as follows. All constructs are based on pgem-3z plasmid (Promega). pgem-, which contains the open reading frame of was generated by cloning PCR-amplified gene into the SmaI site of pgem-3z by blunt-end ligation. pgem-, LacZ5', and LacZ3' was generated by cloning PCR fragments of open reading frame, 5' fragment of LacZ, or 3' fragment of LacZ into EcoRI-

4 A. UAS CORE AA AC AA AC CC CA 37 o C (h): : Cu SRB4 CC srb4-ts CA B. GG UAS CORE GG GC CC CG GC GAL: : Cu SRB4 CC srb4-ts CG Supplementary Figure 2. A. Promoter hybrids between and. The left panel shows the construct used in the experiment. All constructs are based on the 2 micron plasmid and all tested hybrid promoters are fused translationally to the LacZ reporter. Each UAS contains the known binding sites of upstream activators. Core promoter sequences start from approximately 20 bp ( and ) or 40 bp () upstream of the TATA box. The details of UAS and core promoter sequences are described in the Materials and Methods. The right panel shows the S1 assay done with the LacZ probe. For the AA or AC constructs, cells bearing each plasmid were grown to mid-log phase then shifted to 37 C. Cells were collected at the time points indicated. For the CC or CA constructs, cells were grown to mid-log phase then shifted to 37 C and incubated for 1.5hrs. A sample was collected (-Cu), then CuSO 4 was added to 1mM, and incubated for 30min before another sample was collected (+Cu). B. Promoter hybrid between and. Left panel shows the construct used. Right panel shows S1 assay done with LacZ probe. For CC or CG constructs, experiments were done same as CC or CA constructs as in (A). For GG or GC constructs, experiments were done same as CC or CG except 2% galactose was added instead of CuSO 4, and galactose induction was done for 1hr.

5 BamHI site of pgem-3z, respectively. The primers used to amplify each gene fragment are as follows: up: 5'-TTCTGCACAATATTTCAAGCTATACC-3' dp: 5'-GGATCCGGTGTGGTCAATAAGAGCGACC-3' core up: 5 -CGGGATCCTATGGATTGTCAGAATC-3 ORF dp: 5 -CGGAATTCGACTATTCGTTTCATTTCCC-3 LacZ 5' up: CGGAATTCGCCGTCGTTTTACAACGTCGTG-3' LacZ 5' dp: 5'-CGGGATCCCCGACCCAGCGCCCGTTGCACC-3' LacZ 3' up: 5'-CGGAATTCGTGCACCGCTGGATAACGACATTGG-3' LacZ 3' dp: 5'-CGGGATCCGACGGGCTCCAGGAGTCGTCGCC-3' p316:ace1 and p303:acvp were gifts from Dennis Thiele (Pena et al., 1998). p316:acvp was made by digesting p303:acvp with EcoRI-SalI and ligating the fragment containing ACE1- VP16 fusion with EcoRI-SalI-digested prs316 plasmid. This construct contains the Ace1 DNA binding domain (aa 1 to 124 of Ace1) and the acidic activation domain of VP16 (aa 413 to 490). All the other Ace1-fusion constructs are based on the plasmid pac-1. pac-1, which harbored the rest of Ace1-hybrid fusions were generated as follows. The 5 fragment of ACE1 gene, which contains whole promoter region and DNA binding domain (aa 1 to 124 of the Ace1) of Ace1, was PCR amplified. The primers used are as follows: ACE1 N up: 5'-GGGGTACCAAGCTTACGTCTGTGCTGGCCTTGC-3' ACE1 N dp: 5'-CGGGATCCGAATTCCAGATCTGCAATACCGAGACC-3' Also, the region of ACE1 containing the termination codon and the 3 untranslated sequence was PCR amplified. The primers used are as follows. ACE1 C up: 5'-CGGGATCCCTCGAGCAATAATGCATCTGGACATC-3' ACE1 C dp: 5'-CCGGTCTAGAAAGCTTCTCCGATTAGAAGAACAGG-3'. Two PCR products were digested with KpnI-BamHI and BamHI-XbaI, respectively, and threepiece ligated into prs316 to generate pac-1. This resulted in the in frame insertion of three enzymes sites; EcoRI, BamHI and XhoI, where various DNA fragment can be cloned. pac-hsf was generated as follows. A portion of yeast HSF gene, starting from the aa 584 to the EcoRI site located downstream of HSF open reading frame, was PCR amplified using following primers: yhsf 584 up: 5'-CGGAATTCCCTTTTACCTCGCGAGATCC-3' yhsf dp: 5'-CTGTTTCTGCTTGATAATCTG-3' The PCR products were digested with EcoRI-XhoI and cloned into EcoRI-XhoI site in pac-1. To generate pac-gal4, which encodes the Ace1 DNA binding domain fused to the C-terminal activation domain of Gal4 (aa 768 to 881 of Gal4), first pac-1 was digested with EcoRI and subsequently treated with Klenow to fill the end. The resulting DNA was then digested with BamHI and purified. In parallel, a pgad424 plasmid was digested with XmnI-BamHI to release the fragment containing the Gal4 activation domain, which was then ligated with pac-1 from above.

6 To generate pac-srb6, TBP and TAF17, the open reading frame of each factor was PCR amplified and cloned in EcoRI-BamHI site of pac-1. To generate pac-1, the C-terminal region of Gal11 (aa 799 to aa 1081), which was shown to be sufficient to activate transcription when tethered to the DNA binding domain (Barberis et al., 1995), was PCR amplified and cloned in EcoRI-BamHI site of pac-1. The primers used to amplify each factor are as follows: 1 up: 5'-CGGAATTCAATACCGCTAAGTCAACC-3' 1 dp: 5'-CGGGATCCAGTAGCACTTGTCCAATTATTCC-3' SRB6 up: 5'-CGGAATTCATGAGCAACCAGGCACTATATGAG SRB6 dp: 5'-CGGGATCCTTACGTAGTTTTTTCCGCCACG-3' TAF17 up: 5'-CGGAATTCATGAACGGCGGAGGCAAGAATG-3' TAF17 dp: 5'-CGGGATCCTCACATAGACTTTGGGTCCTC-3' ytbp up: 5'-CGGAATTCATGGCCGATGAGGAACG-3' ytbp dp: 5'-CGGGATCCTCACATTTTTCTAAATTCACTTAGC-3' Run-on assay: Using a modified procedure from Elion and Warner (Elion and Warner, 1986). Yeast cells were grown till OD=0.3~0.5, then 8ml of cells was harvested for each reaction. Pellets were quickly frozen in liquid nitrogen and stored at 70 C until use. On the day the runon reaction was done, cell pellets were thawed on ice, then washed twice with 1ml cold water. Cells were then resuspended in 1 ml of ice cold 0.5% sarkosyl solution, and incubated on ice for 15 min. After washing with cold water, cells were resuspended in 85 ul of transcription mix (5ul of 1M Tris ph 8.0, 10 ul 1M KCl, 0.5 ul 1M MgCl 2, 0.1 ul 1M MnCl 2, 2 ul 0.1M DTT, 0.5 ul 100 mm ATP, 0.25 ul 100 mm GTP, 0.25 ul 100 mm CTP, and 66.4 ul water) and 10 ul of 32 P- UTP, then incubated for 2 min on ice. 5 ul of 10% sarkosyl solution was added before the samples were transferred to the 25 o C water bath and incubated for 5 min. Reaction was stopped by adding 1 ml of ice cold water then quickly harvesting and freezing pellet. RNA was purified by acid phenol method (Ausubel et al, 1991). After precipitating RNA pellet, the pellet was dissolved in 128 ul TE, then incubated at 65 o C for 5 min to dissolve RNA. Tubes containing RNA solutions were then placed on ice. 32 ul of ice cold 1M NaOH was added to each tube then incubated on ice for 10 min. Then 50 ul 1M HEPES (ph 7.5) was added to stop the base hydrolysis. 21 ul of 3M NaOAc, and 600 ul EtOH was added to precipitate RNA. These RNA samples were finally dissolved in 100 ul water and added to a prehybridized filter containing gene-specific DNA probes. Hybridization was done for 48hr then filters were washed and exposed on phosphoimager. For preparing filters, 5ug of pgem-3z derived plasmids that contain fragment for each target gene was digested with EcoRI-BamHI to evict the insert. All digest were then mixed together and run in 1% agarose gel. Then the separated DNA fragments were transferred to the Genescreen plus filter by alkaline transfer method (Ausubel et al, 1991). Hybridization and washing were done as manufacture's recommendation. S1 nuclease assay: S1 assay was done as described (Ausubel et al, 1991), except 0.1 pmole of oligos were used per reaction. The sequences of oligos were as follows: : 5'-GCAGCTACCACATTGGCATTGGCACTCATGACCTTCCGGGGT-3'; this hybridizes to the +21 to +66 of coding region from the translation start site LacZ: 5'-GGATAATGCGAACAGCGCACGGCGTTAAAGTTGTTCTGCTTCATCAGCAGG CGCGAA-3'; this hybridizes to to of LacZ coding region in YEp356 from the translation start site.