Supporting Information

Transcription

1 Supporting Information Click Chemical Ligation-Initiated On-Bead DNA Polymerization for the Sensitive Flow Cytometric Detection of 3 -Terminal 2 -O-Methylated Plant MicroRNA Wenjiao Fan, Yan Qi, Liying Qiu, Pan He, Chenghui Liu,* Zhengping Li Key Laboratory of Analytical Chemistry for Life Science of Shaanxi Province; Key Laboratory of Applied Surface and Colloid Chemistry, Ministry of Education; School of Chemistry and Chemical Engineering, Shaanxi Normal University, Xi an , Shaanxi Province, P. R. China Corresponding author: Prof. Dr. Chenghui Liu liuch@snnu.edu.cn (C. Liu) Phone/Fax: List of Contents 1. The nucleic acid sequences used in this study 2. Effect of the length of poly(a)-fam probe 3. The effect of the thermal cycle number on the proposed CCNAL-TEP assay 4. The quantification of ath-mir156a in total Arabidopsis thaliana RNA by using stem-loop RT-PCR method 5. Generality evaluation of Tween-20 on suppressing the nonspecific chemical ligation 6. Discussion about the bimodal phenomena of the fluorescence histograms S-1

2 1. The nucleic acid sequences used in this study Table S1. Nucleic acid sequences used in this work Name ath-mir156a Probe A Probe B Probe C Let-7a Probe A-let-7a Probe B-let-7a mir156a-1 (1 nucleotide difference) mir156a-2 (2 nucleotides difference) mir156a-3 (3 nucleotides difference) mir21 mir122 mir92a mir155 (A)25-FAM Sequences (5-3 direction) UGACAGAAGAGAGUGAGCAC-2 me biotin-cccccccccc(spacer)-gtgctcactc-dbco N 3 -TCTTCTGTCA N 3 -TCTTCTGTCA-FAM UGAGGUAGUAGGUUGUAUAGUU biotin-cccccccccc(spacer)-aactatacaac-dbco N 3 -CTACTACCTCA UGAGAGAAGAGAGUGAGCAC UGAGAGAAGAGAGUCAGCAC UGAGAGAACAGAGUCAGCAC UAGCUUAUCAGACUGAUGUUGA UGGAGUGUGACAAUGGUGUUUG UAUUGCACUUGUCCCGGCCUGU UUAAUGCUAAUCGUGAUAGGGGU AAAAAAAAAAAAAAAAAAAAAAAAA-FAM Note: 2 me at the 3 -terminus indicates 2 -O-methylation. The solid underlined sequences of the probes are complementary to the corresponding solid underlined sequences in the target mirnas, while the dot underlined sequences in the probes are complementary to the dot underlined sequences in target mirnas. S-2

3 2. Effect of the length of poly(a)-fam probe Figure S1. Effect of the length of poly(a)-fam probe on the proposed CCNAL-TEP strategy for ath-mir156a analysis. 50 pm of ath-mir156a was used for this optimization (green lines) in comparison with blank control (red lines). The length of poly(a)-fam: (a) (A)5-FAM; (b) (A)15-FAM; (c) (A)25-FAM; (d) (A)30-FAM. We have optimized the length of the FAM-labeled poly(a) oligonucleotides ((A)n-FAM, where n is the length of A). From the results shown in Figure S1a, when (A)5-FAM is used, the 50 pm ath-mir156a-produced fluorescence response is so weak that it cannot be discriminated from the blank control. (A)5-FAM is too short so that the melting temperature between (A)5-FAM and the poly(t) tail is far below the room temperature. Since the flow cytometer (FCM) analysis is conducted at room temperature, (A)5-FAM cannot bind with the poly(t) tail on the MBs so that the fluorescence signal is negligible. If (A)15-FAM is employed (Figure S1b), the target-produced fluorescence response can be clearly discriminated from the blank control, but the fluorescence response is also quite low because the hybridization between (A)15-FAM and poly(t) tail is also unstable. As shown in Figure S1c and S-3

4 S1d, the duplexes between the poly(a) oligonucleotides and the poly(t) tail become strong enough when the length of poly(a) reaches 25 to 30. It is worth noting that further increase of the poly(a) length will adversely reduce the binding capacity of fluorophores loaded on the MBs. In consideration of both high binding stability of the poly(a)-fam probe and high detection sensitivity, (A)25-FAM is selected as the optimum in this study. 3. The effect of the thermal cycle number on the proposed CCNAL-TEP assay Figure S2. Fluorescence histograms of the CCNAL-TEP system for ath-mir156a analysis with different thermal cycle numbers. 50 pm of ath-mir156a was used for this optimization (green lines) in comparison with blank control without adding ath-mir156a (red lines). The number of thermal cycles: (a) 0; (b) 10; (c) 20; (d) 30; (e) 40; (f) 50; (g) 60; (h) 80; (i) 100. Other conditions: TdT, 2 U; dttp, 1 mm. It should be noted that in image (a), although no thermal cycling is used, the ligation reaction is conducted at a constant temperature of 25 o C with the reaction time identical to 60 cycles. FL1 Voltage for the FCM measurement, 330 V. In order to achieve the best assay performance, the number of thermal cycles in the CCNAL-TEP were studied. As shown in Figure S2, one can see that the fluorescence signal produced by 50 pm ath-mir156a increases gradually as the number of thermal cycles increases from 0 to 100. Meanwhile, the fluorescence signals of the blank control without ath-mir156a almost keep constant when the range S-4

5 of cycle number is 0~50. However, when the cycle number reaches 60 or higher, the blank signal also increases obviously (Figure S2f~i), which is undoubtedly unfavorable for the detection of low concentrations of target mirna. What is more, if 100 cycles are used, the cycling click reaction time will need more than 6h, which may be too long for practical applications. In consideration of both appropriate assaying time and high sensitivity, 50 cycles are selected as the optimum for the CCNAL reaction in this work. 4. Quantification of ath-mir156a in total Arabidopsis thaliana RNA by stem-loop RT-PCR method The stem-loop reverse-transcription PCR (RT-PCR) protocol is referred to the methods in the literatures with some modifications, 1, 2 which consists of two processes, namely, reverse transcription (RT) and real-time PCR. For the first process, the stem-loop RT-Probe is hybridized to the target mirna, and then reversely transcribed. Then the reverse transcription products are amplified and detected by fluorescence quantitative real-time fluorescence PCR using SYBR Green I as the signal reporter. The detailed experiment procedures are listed as follows: Reverse transcription reaction. The reverse transcription reaction was carried out in the mixture with 1 µl target mirna (or total RNA sample), 1.2 µl of RNase-free water, 1 µl of 5 RT buffer (50 mm Tris-HCl, 75 mm KCl, 3 mm MgCl 2 ), 1 µl of 2.5 mm dntps, 0.2 µl of 200 U/µL ProtoScrip II reverse transcriptase, 0.5 µl of 1 µm stem-loop RT-Probe (see detailed sequence in Table S2) and 0.1 µl of 40 U/µL RNase inhibitor. The 5 µl mixture was treated with following conditions: 30 min at 16 o C, 30 min at 42 o C, 5 min at 85 o C and then held at 4 o C. Quantitative real-time PCR analysis. The 5 µl transcription product was added into the PCR reaction mixture with a final volume of 10 µl. The PCR reaction mixture consists of 200 nm forward primer and 200 nm reverse primer (see detailed sequence in Table S2), 250 µm dntps, 0.4 SYBR Green I, 0.5 U JumpStartTM Taq DNA Polymerase and 1 PCR buffer (10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl 2, 0.001(w/v) gelatin, ph 8.3). The 10 µl PCR reaction mixture was incubated in a StepOne Real-Time PCR System (Applied Biosystems, USA) according to the following thermal cycling conditions: hot start at 94 o C for 2 min, followed by 50 cycles of 94 o C for 15 s, 60 o C for 1 min S-5

6 and 72 o C for 20 s. Table S2. Nucleic acid sequences used in stem-loop RT-PCR method Name Stem-loop RT-Probe (for the RT-PCR method) Forward primer (for the RT-PCR method) Reverse primer (for the RT-PCR method) Sequences (5-3 direction) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGT GCTC GCCGCTGACAGAAGAGAGTG GTGCAGGGTCCGAGGT Figure S3. (a) Standard calibration curve of the stem-loop RT-PCR protocol for the detection of ath-mir156a, which is constructed by using series dilutions of synthetic ath-mir156a standard; (b) the comparison of the determined amount of ath-mir156a in 50 ng of the same batch of total Arabidopsis thaliana RNA by using the stem-loop RT-PCR protocol and the proposed CCNAL-TEP strategy, respectively. 5. Generality evaluation of Tween-20 on suppressing the nonspecific chemical ligation To evaluate the generality of Tween-20 on suppressing nonspecific chemical ligation, we have further examined the critical role of Tween-20 on the detection of let-7a mirna by using the let-7a-specific Probe A and Probe B, whose sequences are totally different from those for ath-mir156a analysis. As can be seen from Figure S4, if Tween-20 is absent, the nonspecific signal of blank control (in the absence of let-7a) is so significant that the 50 pm let-7a-aroused fluorescence response cannot S-6

7 be distinguished from the blank control. As a contrast, when Tween-20 is introduced, the nonspecific signal of blank control can be sharply reduced while the 50 pm target-produced signal still remains high enough. Such results are well consistent with those for ath-mir156a analysis. Therefore, it can be concluded that the fascinating effect of Tween-20 on suppressing nonspecific chemical ligation is general for different sequences. Figure S4. The effect of Tween-20 on suppressing nonspecific chemical ligation for let-7a analysis by using let-7a sequence-specific Probe A and Probe B. 50 pm of let-7a was used in this study (green lines) in comparison with blank control (red lines) by using Tween-20 dosage of (a) 0; (b) 0.01%. FL1 Voltage for the FCM measurement, 330 V. 6. Discussion about the bimodal phenomena of the fluorescence histograms One can see that in this study, all of the fluorescence histograms tend to show bimodal. Actually, the bimodal phenomena in the fluorescence histograms should be due to the inevitable presence of doublets of the commercially purchased M-270 MBs (Dynabeads). Figure S5 (a) shows the SSC vs FSC plots of the pure M-270 MBs, the MBs involved in the blank control as well as the MBs treated with ath-mir156a in the CCNAP-TEP system. As can be seen that the three kinds of beads all exhibit two populations, and the percentages of population 1 (P1) and population 2 (P2) are roughly identical. As shown in Figure S5a, over 92% of the beads with low scattering should be assigned as monodisperse single MBs (P1), while the P2 (~7%) with higher scattering signal should be assigned to the inevitable doublets aggregates. S-7

8 What is more, as shown in Figure S5b, both for the blank control and the mirna-containing samples in the CCNAL-TEP system, the fluorescence histograms are unimodal (only a single peak is observed) when we only gate the P1. However, when P1 and P2 are both gated, the fluorescence histograms tend to show bimodal. So the weak fluorescence peak with higher intensity should be corresponding to the doublets aggregates existed in the commercial MBs. In this work, in order to faithfully reflect the target mirna level by using MFI of the MBs, we collected the FL1 intensity of all events including both P1 and P2 so that bimodal histograms are observed. Since the proportion of the doublets is almost constant no matter the ath-mir156a exists or not, the bimodal fluorescence histograms will not affect the accuracy of our method for mirna quantification. S-8

9 Figure S5. (a) The SSC vs FSC scattering plots of the pure M-270 MBs, the MBs involved in the blank control as well as the MBs treated with ath-mir156a in the CCNAL-TEP system. (b) The histograms of the MBs involved in the CCNAL-TEP system (both the blank control and the 50 pm S-9

10 ath-mir156a-treated MBs are presented respectively) when different populations are gated. In Figure S5b, the right panel is the fluorescence histogram corresponding to the left scattering plot and gating, respectively. References (1) Chen, C.; Ridzon, D. A.; Broomer, A. J.; Zhou, Z.; Lee, D. H.; Nguyen, J. T.; Barbisin, M.; Xu, N.; Mahuvakar, V. R.; Andersen, M. R.; Lao, K.; Livak, K. J.; Guegler, K. J. Nucleic Acids Res. 2005, 33, e179. (2) Chen, F.; Fan, C.; Zhao, Y. Anal. Chem. 2015, 87, S-10