TILLING Resources for Japonica and Indica Rice

Transcription

1 TILLING Resources for Japonica and Indica Rice Luca Comai, Steve Henikoff, Tom Tai, Hei Leung TILLING Resources for Japonica and Indica Rice Outline Who: Seattle TILLING Project (Luca Comai, Steve Henikoff) ARS-Davis (Tom Tai) IRRI (Hei Leung) Contact: What: mutagenized populations and TILLING service How: user places order for gene in web site we process order and identify mutations user gets stock #, orders it, uses it Here: introduction, progress 1

2 TILLING Targeting Induced Local Lesions IN Genomes 1. Make EMS-mutagenized population 2. Target gene of interest with PCR primers 3. Search for rare mutants among many individuals Goal: a Rice TILLING Service 2

3 EMS mutagenesis 06/N7-ethylguanine AAGAA EMS AAGAA TTCTT TTTTT +replication +replication AAAAA TTTTT Soak in EMS mutants Chemical mutagens provides a range of mutation types functionality wild-type protein altered truncated missense CGA --> CAA R --> Q improper RNA splicing.ag_gt -->.AA_GT Intron Exon nonsense CGA --> TGA R --> STOP 3

4 Rice mutagenesis EMS or MNU or MNU+NaN 3 seed flower M1 M2 bank DNA and seed M3 seed Pool and array M2 plants DNAs 8X pool 384x8 individuals/ plate 2-D pooling provides address of unique individual 4

5 Choosing the window to till Exons vs introns Codon type (AAA vs TGG) Conserved motifs gene model primers PCR tilled fragment 0.5 to 1.5 kb Codons Optimized to Discover Deleterious LEsions Α Β Χ CODDLE program suggests region to TILL P of deleterious changes 5

6 CODDLE, display of possible changes E F T R S S R A R R R Y W A R S Y ag gag ttt act cga tca agc cga gct cgt agg cgg tat tgg gcg agg agt tac 1456 # K = I *Q L N= *Q TV CH K= WQ= ** TV= K= N = A G W R R F T A A Q P G P A H T A L gct gga tgg agg agg ttc act gca gca caa cca gga cca gct cat act gct tta 1510 TV RE ** K= K= = I TV TV * SL RE SL TV Y I TV A S L E K A G R I N F M I T Q N V D gca tca cta gaa aaa gct gga cga ata aat ttt atg atc aca caa aat gtt gac 1564 TV L = K TV RE *Q I = I * I N = R ag gtatatccttcagttcctcttccgtaggatctctgttggatgtgaagaatgttgactctaagctctaa 1634 K # ^^ ^ ^ ^^ ^ ^^^ ^^ ^ ^ ^ ^^ ^ ^ ^ ^ ^ ^ ^ ^^ ^ L H H R A G S D P L E L H G T gttgttag g ttg cat cat cgt gct ggg agc gat cca ctt gaa tta cat ggc aca 1688 ^ ^ # = = Y Y CH TV RE= N= N SL F K Y SD= I V Y T V M C L E C G F S F P R D L F gta tat act gtt atg tgc tta gag tgc ggc ttc tct ttt ccc cga gac ttg ttt 1742 I I I I Y= K = Y= SD= = F SL= *Q N = = Q D Q L K A I N P K A S cag gat cag cta aaa gca atc aat cct aag gcc agt gtataccataacctgaataaact 1801 * = N * = = TV = SL = TV= N # ^^ ^^ ^ ^ Formation of heteroduplexes in pooled DNAs G C A T PCR products heat anneal G C A T homoduplexes A C G T heteroduplexes 6

7 CelI detection of mutations fluorescent primers PCR, heat, anneal CelI denature Detection is on Licor analyzers IRD700 IRD800 7

8 Agarose gel detection of dsdna products CelI Fulin Qiu, Chitra Raghavan, Janli Wu, Ken McNally, Hei Leung (IRRI) Effect of mutation density on cost $ zebrafish soybean maize arabidopsis wheat 4X wheat 6X fruit fly barley rice? kb/mutation 100 1,000 8

9 Pilot screen Test 768 individuals Use 6-8 genes (~6 Mb DNA) Array in 2-D scheme Derive an approximate mutation rate Decide on scale up Populations tested variety stage mut. conc. from mut/mb IR-64 seed EMS 0.8% IRRI > 1 IR-64 seed EMS 1.2% IRRI > 1 M202 japon. seed Az-MNU 5mM Davis > 1 M202 japon. seed Az-MNU 7.5mM Davis > 1 T65 japon. flower MNU N. Kurata IR-64 seed EMS 1.6% IRRI ~ 1 IR-64 seed EMS 2% IRRI 0.7 Nipponb. seed Az-MNU 15mM Davis ~ Nipponb. seed EMS 1.5%, Davis ~

10 TILLING in indica Rice Indica IR64: ~1 mutation/mb TILLING NaAz/MNU Nipponbare OsDREB IRD700 IRD800 1 mut/350 kb 10

11 Effect of mutation density on cost $ zebrafish soybean maize arabidopsis wheat 4X wheat 6X fruit fly barley rice kb/mutation 100 1,000 What determines the mutation rate? Concentration of mutagen Environment Genotype --> sensitivity to mutagen 11

12 Wide variation in EMS tolerance (RILs of Col x Kas) control EMS control EMS RIL 7 RIL 12 RIL 23 RIL 76 (RIL pop. and map by Wilson and Somerville,2000; also Wolyn,2004) TILLING SERVICES Arabidopsis: opened genes, 6,300 mutations Maize: opened Dec 2004, Fly: opened March 2005, 12

13 Production scale Produce a minimum of 3,500 M2s and 7,000 if possible Collect DNA and seed (~50-100) from each Balance DNA concentrations, and pool 8x Array in 2-D scheme Rice TILLING service Targeted for late 2006, as beta Web based interface for orders Cost $500 to 750 per order until NRI $ last, then $1,500 per order (full cost) -> 12 mutations Deep search of all 7,000 lines $2,500 -> 24 mutations Order stock on line to Dale Bumpers center in Stuttgart 13

14 PARSESNP report on TILLED gene Summary Scale up of 1m MNaAz + 15mM MNU in progress at Davis IRRI is scaling up a 2-step sequential EMS Sequence resources, detection system, method of mutagenesis ready Service expected by late 2006, probably as beta version 14

15 TILLING credits Seattle TILLING Project Jennifer Cooper Brad Till Elisabeth Bowers Chris Burtner Christine Codomo Aaron Holm Nina Miller Rob Laport Kim Young Steve Henikoff Luca Comai ARS-Davis Tom Tai Peter Colowit IRRI Hei Leung Fulin Qiu Chitra Raghavan Janli Wu Ken McNally FUNDING Computational Elizabeth Greene Nick Taylor Jorja Henikoff Samson Kwong Troy Zerr Rice Collaborators Nori Kurata and thanks to S. McCouch Cooperative State Research, Education and Extension Service Rockefeller Foundation (indica) 15