AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
|
|
- Eric May
- 5 years ago
- Views:
Transcription
1 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell /tpc BD AD-YAB BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4 3AT AD-YAB3 BD-JAZ3-4 3AT BD-JAZ3 Supplemental Figure 1. Yeast two-hybrid assay showing FIL-JAZ3 interaction in the presence of 3-aminotriazole. (A) Yeast two-hybrid assay using JAZ fused to the GAL4 Binding Domain (BDJAZ) and FIL/YAB fused to the GAL4 Activation Domain (AD-FIL/YAB). Yeast cells cotransformed with the indicated combinations were selected in medium lacking Leu and Trp (-2) and grown for 5 days in medium lacking Ade, His, Leu and Trp without or with 5 mm 3-aminotriazole (-4, -4AT) to select for interactions. BD represents the empty pgbkt7 vector. Numbers above the panel represent JAZs proteins, from JAZ1 (1) to JAZ12 (12). (B) Yeast two-hybrid assay using JAZ3 fused to the GAL4 Binding Domain (BDJAZ3) and FIL/YAB fused to the GAL4 Activation Domain (AD-FIL/YAB). Yeast cells cotransformed with the indicated combinations were selected in medium lacking Leu and Trp (-2) and grown for 5 days in medium lacking Ade, His, Leu and Trp without or with 3-aminotriazole (-4, -4AT) to select for interactions. BD represents the empty pgbkt7 vector. 1
2 25 Col0 35s:FIL-GR * 20 A530/g FW * 0 Control COR DEX DEX+COR Supplemental Figure 2. Anthocyanin content of 7-day-old 35S:FIL-GR transgenic Arabidopsis seedlings grown on MS medium supplemented with 10 µm Dexamethasone (DEX) plus/minus 1 µm Coronatine (COR; a mimic of JA-Ile). EtOH was the solvent used for Cor stock and was added in control treatments. DMSO is the solvent used for DEX stock and was added in control treatment. Error bars represent SD. Asterisks indicate statistically significant differences between 35S:FIL-GR and Col0 in each condition (p-value<0.01, t-test). 2
3 A Hypocotyl lentgh (cm) 0,7 0,6 0,5 0,4 0,3 0,2 0,1 Col0 % Inhibition ,0 Dex Dex+JA 0 B 0,6 Control 50 µm JA 0,5 Hypocotyl length (cm) 0,4 0,3 0,2 * * 0,1 0,0 Ler fil fil/+ yab3 fil yab3 Coler yab235 fil yab235 Supplemental Figure 3. Hypocotyl growth of 35s:FIL-GR and yab mutants in the presence/absence of JA. (A) Hypocotyl growth inhibition by JA of 10-day-old wild-type wt Col0 plants versus 35S:FIL-GR grown in MS medium for 5 days and supplemented with 20 µm Dex plus/minus 50 µm JA for 5 days more (left panel). Right panel represents the same data as % hypocotyl growth inhibition of JA treated plants compared with Dex treatment. For hypocotyl growth assays seedlings were grown under continuous white light conditions. Error bars represent standard deviations. (B) Hypocotyl growth inhibition by JA of wild-type (Ler or Coler) plants versus yab mutants grown in MS medium plus/minus 50 µm JA under continuous light conditions presented as in (A). Error bars represent SD. Asterisks indicate statistically significant differences between the corresponding samples and Ler (p-value<0.01, t-test). 3
4 3,50 3,00 control 50 µm JA Root length (cm) 2,50 2,00 1,50 1,00 0,50 0,00 Ler fil fil/+ yab3 fil yab3 Coler yab235 filyab235 Supplemental Figure 4. Root growth inhibition of 7 days-old wild-type and yab mutants. Seedlings were grown in MS medium plus/minus 50 µm JA under continous light conditions. fil/+ indicate heterozygous for fil mutation. Error bars represent standard deviations. 4
5 Col0 35S:FIL-GR coi1-30 Coler fil/+ yab235 Supplemental Figure 5. Disease symptoms in leaves of wild-type, yab mutants and 35S:FIL-GR lines. Photographs of detached leaves were taken 4 days after inoculation. 5
6 A ctaggttttccatcgtacacgtaaattttcatgcaagaaagcagaaatatacaaatactaacttttagatac tgaaaaatgagatcagattctagtcaaattttgttaaaagtatttataaatttaaattgcaagtcctcaaaa agtacgactaaaaatgcttttcttagaaaatgataataaaccggcgttttatatataagtgtttctttttct cttctgtccagaagtaaatcattaagaaccaatatggcttttcttaaactaatctccgtgataatcaaatct ttgatcattctccacacaatcccatcaacaacatcgatctcactagatgcaccaacaatgattctaatcggc actactaactatagagatagttgtcccaaaaaaaaaaaaaaaaactaactagagagataaatcatattcaat acatgtactatttctactatacttaagaaaatttgtataccactatcttaactcttaacactgaacatacta tacactatcttaactcccaactcttgtaaaagaatatctaattttaagaaaagacttcaaatgcttgttaaa tttctagtgaagatgcacattctaaaaactggtaaaatggtaagaaaaaaatatataaaaaaatagccttat taaaatttatatctcctatttctctatccaaactacacggatgaagcttattgttattcatccacccttttt ctcaattctgtcctatttcttgtgcatgaaacttctccatcttgtaatcggataaatcatacccaaattttt tctttctgaaaacatatatacccgaacattaattactatcgtcctttctcctaattttgttaagaaacatgt ttgtttgtttttagtactgaaaaaggatggagatacttgctagatcctatgaaccttttctctctaggacaa atcagtaaccaaacaataacttagcaaattaagcacgacagctaatacataaaatgtggatatcaaacatgc acgtcacttccttttttccgtcacgtgtttttataaattttctcacatactcacactctctataagacctcc AATCATTtgtgaaaccatactatatataccctcttccttgaccaatttacttataccttttacaatttgttt atatattttacgtatctatctttgttccatg -1 Putative FIL binding element G-box B -463 FBE2 G-box FBE1-1 Supplemental Figure 6. Nucleotide sequence and graphic representation of MYB75/PAP1 promoter. (A) Nucleotide sequence of the MYB75/PAP1 promoter fragment used in this work, highlighting the putative FIL DNA-binding elements (Cyan) and a G-box (yellow, used as unspecific competitor probe in EMSA experiments). (B) Graphic representation of MYB75/PAP1 promoter highlighting putative FIL binding elements (FBE1 and FBE2) and the G-box used in EMSA experiments shown in Figure 7D. Numbers refer to nucleotide position from the ATG. 6
7 Ler fil yab3 Coler fil yab235 Supplemental Figure 7. Anthocyanin accumulation on 5 days-old Arabidopsis fil yab3 and fil yab2 yab3 yab5 mutants compared with their respectives wild-types (Ler, for upper panel and Coler for bottom panel) grown in MS medium with 50 µm JA. Arrows and arrowheads point to cotyledons and hypocotyl differences, respectively. Major differences are detected at cotyledon whereas hypocotyl shows minor differences. Scale bar=2 mm. 7
8 Supplemental Table 1. Oligonucleotides used for cloning. YAB5 fw YAB5 rev YAB1 fw YAB1 rev YAB2 fw YAB2 rev YAB3 fw YAB3 rev pmyb75 fw pmyb75 rev ggggacaagtttgtacaaaaaagcaggcttcatggctaactctgtgatggc ggggaccactttgtacaagaaagctgggtcttaggctatcttagcttgcttg ggggacaagtttgtacaaaaaagcaggcttcatgtctatgtcgtctatgtc ggggaccactttgtacaagaaagctgggtcttaataaggagtcacaccaac ggggacaagtttgtacaaaaaagcaggcttcatgtctgtagatttctcatctg ggggaccactttgtacaagaaagctgggtcttagtaatagccattagacttttg ggggacaagtttgtacaaaaaagcaggcttcatgtcgagcatgtccatgtcg ggggaccactttgtacaagaaagctgggtcctagttatgggccaccccaacg ggggacaagtttgtacaaaaaagcaggcttcctaggttttccatcgtacacg ggggaccactttgtacaagaaagctgggtccatggaacaaagatagatacgt 8