UNIT 3B. Yesterday s Picture DNA RNA. protein

Transcription

1 Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles, including the nucleus, in your description. (LO 4.4)

2 Yesterday s Picture DNA RNA protein

3 Introns and Phenotypes

4 Introns and Phenotypes In prokaryotes, transcription is coupled to translation. transcription translation

5 Introns and Phenotypes In prokaryotes, transcription is coupled to translation. In eukaryotes, mrna exports from the nucleus to the ribosome. DNA RNA nucleus transcription translation ribosome protein

6 Introns and Phenotypes In prokaryotes, transcription is coupled to translation. In eukaryotes, mrna exports from the nucleus to the ribosome. Before leaving the nucleus, RNA is post-transcriptionally processed. 3 poly-a tail is added 5 methyl-g cap is added Introns are excised (cut out)

7 Introns and Phenotypes In prokaryotes, transcription is coupled to translation. In eukaryotes, mrna exports from the nucleus to the ribosome. Before leaving the nucleus, RNA is post-transcriptionally processed. 3 poly-a tail is added 5 methyl-g cap is added Introns are excised (cut out)

8 Introns and Phenotypes In prokaryotes, transcription is coupled to translation. In eukaryotes, mrna exports from the nucleus to the ribosome. Before leaving the nucleus, RNA is post-transcriptionally processed. 3 poly-a tail is added 5 methyl-g cap is added Introns are excised (cut out) The remaining exons (mature mrna) export from the nucleus. pores mature mrna tch?v=yqesr7e4b_8

9 CTQ #1 A gene encodes a pre-mrna with the following sequence: 5 GCAUGGGGGAUAAGAAUCGCGCAAUUU GCGGCGAAAAGCUAGGUCACACGAGUAA 3 The underlined sequences represent introns, and the nonunderlined sequences represent exons. Predict the aminoacid sequence of the translated polypeptide.

10 Protein Synthesis: The Central Dogma of Biology Mature mrna encodes a protein, which has a specific function. Pigmentase gene Pigmentase mrna Pigmentase protein

11 Protein Synthesis: The Central Dogma of Biology Mature mrna encodes a protein, which has a specific function. The observable effect of this function is called a phenotype. Observable bluepigment phenotype Pigmentase gene Pigmentase mrna Pigmentase protein

12 Protein Synthesis: The Central Dogma of Biology Mature mrna encodes a protein, which has a specific function. The observable effect of this function is called a phenotype. The lactose tolerance phenotype is based on the activity of the lactase gene. H 2 O lactase gene Lactose Glucose + Galactose lactase mrna Lactase protein (an enzyme) High lactase activity = lactose tolerant Low lactase activity = lactose intolerant

13 Protein Synthesis: The Central Dogma of Biology Mature mrna encodes a protein, which has a specific function. The observable effect of this function is called a phenotype. The lactose tolerance phenotype is based on the activity of the lactase gene. Northern European peoples began domesticating cows for milk ~7,000 years ago. Other peoples have historically relied much less on milk. Percentage of lactoseintolerant people.

14 CTQ #2 Predict the effects on lactase function if the third codon of lactase gene was mutated to change the mrna sequence from UAU to UAG. Justify your prediction. (LO 3.6)

15 Closure Describe how the unique structure of eukaryotic cells prevents translation from being coupled to transcription.