Quantifying small numbers of antibodies with a near-universal protein-dna chimera

Transcription

1 Quantifying small numbers of antibodies with a near-universal protein-dna chimera Ian Burbulis, Kumiko Yamaguchi, Richard Yu, Orna Resnekov & Roger Brent Supplementary figures and text: Supplementary figure 1 Fusion protein expression, purification, and conjugation to DNA. Supplementary figure 2 The LG tadpole binds mouse IgG with high affinity. Supplementary figure 3 The LG tadpole does not bind chicken IgY. Supplementary figure 4 Quantification of INFA-TAP by IgY-IgG immunoglobulin sandwich and tadpoles. Supplementary figure 5 Quantification of human interlukin-6 (IL6) spiked into mouse serum. Supplementary figure 6 Quantification of recombinant E.coli initiation factor- TAP fusion (INFA-TAP) by ELISA. Supplementary figure 7 Quantification of human interleukin-6 (IL6) by ELISA. Supplemental table 1 Calf and human serum does not interfere with tadpole assay.

2 Supplementary Figure 1 Fusion protein expression, purification, and conjugation to DNA. a b c Synthesis of the LG tadpole. (a) We synthesized the primers (5 atatcatatgaaaaaaactgctatcgctatcg) and (5 atatgctcttccgcattcagttaccgtaaaggtcttagtc), PCR amplified the LG coding sequence, and ligated in-frame with a self-cleaving mini-intein 1 and chitin-binding domain 2 to create pib150. After confirming proper orientation and sequence by direct sequencing, we transformed Rosetta-gami B (DE3) plyss (Stratagene) with pib150 and induced trans-gene expression for 3 hours with 0.5 mm IPTG at 25 C. We collected cells by centrifugation, briefly sonicated, and recovered fusion protein with 3 ml of Ni2+ sepharose (Qiagen). We supplemented 5 mg of fusion with 10 mm 2-mercaptoethanesulfonic acid (MESNA) and equimolar cysteine-modified DNA for four hours at 32 C. Here, we resolved samples containing recombinant fusion protein and cysteine-modified dsdna with (lane 2) and without (lane 1) MESNA and TCEP on a native 10% Tris-borate-EDTA polyacrylamide gel. The upper arrow indicates the more slowly migrating tadpole. (b) We confirmed that the slower migrating DNA was sensitive to proteinase K by digesting with 0.1 mg / ml at 37 C for 1 hour and resolving on a gel (lane 2), as above. The lower arrow indicates the increased mobility of digested tadpole to a size consistent with free dsdna alone (lane 1). (c) We confirmed that the slower migrating DNA binds mouse and rabbit immunoglobulin by incubating with either mouse IgG- (lane 2), rabbit IgG- (lane 3), or ethanolamine-coated magnetic beads (lane 4) and resolving the supernatants after bead depletion by gel, as above. Lane 1 is tadpole alone.

3 Supplementary figure 2 The LG tadpole binds mouse IgG with high affinity. a b Tadpole (nm) Bound*100 Measurement of LG tadpole affinity for mouse IgG coated beads (a) We seriallydiluted the LG tadpole 1:10 into blocking buffer (0.2% casein, 0.01% tween-20, PBS), added 100,000 beads covalently linked to mouse total IgG to each dilution, and incubated at 22 C for one hour. The beads were collected and washed five times before we counted the number of tadpoles bound to 5000 beads in three replicates by real-time PCRs containing hydrolysis probes. Here, we graph the number of bound tadpoles per bead as a function of tadpole concentration. (b) We transform this binding data into a scatchard plot using the program Prism 4.0. We calculate 2925 binding sites per bead and an aggregate dissociation constant of 3.4 nm from the measured values using the equation: Y = Bmax * X / (Kd + X), which describes the binding of a ligand to receptor following the law of mass action.

4 Supplementary figure 3 The LG tadpole does not bind chicken IgY log 10 [tadpole] We serially diluted LG tadpole 1:100 in blocking buffer and incubated 50 ml of each dilution with either mouse IgG-, chicken polyclonal anti-protein A IgY-, or ethanolamine-coated beads for 1 hour at 22 C. After washing the beads we counted the number of bead-bound tadpoles using real-time PCR containing hydrolysis probes. Here, we graph the number of PCR cycles necessary to reach detection threshold as a function of antibody-binding tadpole concentration. The circles represent the PCR signal from samples that included mouse IgG-coated beads, while the squares and triangles represents the PCR signal from samples incubated with IgY- and ethanolamine-coated beads, respectively. We couldn t get the tadpole concentration high enough to saturate all the binding sites on the IgY and ethanol coated beads, and thus can not directly measure Bmax. However, if we assume that the number of binding sites on these beads are equivalent to the IgG beads (roughly 3000), the estimated dissociation constants for IgY and ethanol-coated beads would be 143 mm and 358 mm, respectively.

5 Supplementary figure 4 Quantification of INFA-TAP by IgY-IgG immunoglobulin sandwich and tadpoles log 10 (N) We captured soluble INFA-TAP from serial dilutions with chicken anti-protein A IgY coated beads, incubated with rabbit polyclonal anti-tap IgG then LG tadpole, and quantified using real-time PCR containing a hybridization probe. Here, we graph the mean PCR cycles/n INFA-TAP molecules (solid curve) and the confidence belt, corresponding to 2 SD. (dashed curves) from three replicates. The dashed arrow indicates the limit of detection and the solid arrow indicates the middle of the linear range where we calculate precision.

6 Supplementary figure 5 Quantification of human interlukin-6 (IL6) spiked into mouse serum log 10 (N) We captured IL6 from serial dilutions of spiked mouse serum (Jackson Immunological) using magnetic beads coated with chicken anti-il6 IgY (Genway), detected bound IL6 with rabbit polyclonal anti-il6 IgG (Pierce) and quantified using the LG tadpoles and real-time PCR. Here, we graphed the mean PCR cycles/n molecules (solid curves) for hil6. We plotted the confidence belts, corresponding to 2 SD. (dashed curves) from 3 replicates. The dashed arrow indicates the limits of detection and the solid arrow indicates the middle of the linear ranges where we calculate precision for these assays (defined above).

7 Supplementary figure 6 Quantification of recombinant E.coli initiation factor- TAP fusion (INFA-TAP) by ELISA log 10 [INFA-TAP] We coated the wells of polystyrene Immobilon II ELISA plates (Corning) with 100 ml of 2 mg/ml chicken polyclonal anti-protein A IgY in phosphate-buffered saline for 2 hours and blocked unoccupied sites using 0.2 % heat-denatured casein in PBS. We added 10-fold serial dilutions of INFA-TAP to these wells and incubated for 1 hour at 22 C and washed unbound INFA-TAP from wells. We detected bound antigen by incubating samples with rabbit polyclonal anti-tap IgG (Open Biosystems) pre-diluted 1:1000 in blocking buffer for 1 hour. The samples were washed free of rabbit antibody before we incubated with either horseradish peroxidase-conjugated goat polyclonal anti-rabbit IgG (Pierce) or horseradish peroxidase-conjugated goat polyclonal anti-mouse IgG (Pierce), both pre-diluted 1:3000 in blocking buffer, as above. We measured enzyme activity by adding 100 ml of 0.5 mg/ml o-phenylenediamine dihydrochloride dissolved in 0.05 M citric acid, 0.05 M sodium phosphate (ph 5), containing 0.03 % hydrogen peroxide before reading absorbance at 450 nm. Using the statistical methods described above we measured a limit of detection for INFA-TAP to be 2.62 nm, while little signal above background was detected using goat polyclonal anti-mouse conjugates indicating the quantification of INFA-TAP was specific. We accounted for non-specific and cross-reactive signal as above.

8 Supplementary figure 7 Quantification of human interleukin-6 (IL6) by ELISA log 10 [IL6] We coated the wells of polystyrene Immobilon II ELISA plates (Corning) with 100 ml of 2 mg/ml chicken polyclonal anti-il-6 IgY (Genway) in phosphate-buffered saline for 2 hours and blocked unoccupied sites using 0.2% heat-denatured casein in PBS. We serially diluted IL6 into these wells, incubated for 1 hour at 22 C, and washed unbound IL6 from wells. We detected IL6 by sequentially incubating samples with diluted (1:1000) rabbit polyclonal anti-human IL6 IgG (Pierce) and and horseradish peroxidase-conjugated goat polyclonal anti-rabbit IgG (Pierce) for 1 hour each. We measured enzyme activity by adding 100 ml of 0.5 mg/ml o-phenylenediamine dihydrochloride dissolved in 0.05 M citric acid, 0.05 M sodium phosphate (ph 5), containing 0.03% hydrogen peroxide before reading absorbance at 450 nm. Using the statistical methods outlined above we measured a limit of detection for hil6 to be 18 picomolar. We corrected for non-specific and cross-reactive signal as above.

9 Supplemental Table 1 Calf and human serum does not interfere with tadpole assay. sample Spike level (ng/ml) Expected Observed Recovery % Healthy Human serum High Medium Low Heart High Medium Low Prostate High Medium Low We spiked the human sera described in the text with three concentrations of purified human PSA that span a range typically encountered in the clinic. We quantified PSA, and calculated recoveries of PSA from test serum samples by comparison to recovery of pure PSA diluted into dilution buffer. Columns of the table indicate the serum samples, the final concentration of the added PSA spike, the concentration measure in buffer (expected), the specific concentration of spiked PSA measured in the test sera (observed), and the relative abundance of PSA quantified in these two samples expressed as a percent (recovery %). For the human sera, the values we report for spiked samples reflect subtraction of the measured endogenous PSA value (no-spike; also supplied by the vendor, Asterand, Inc.), non-specific, and cross-reactive signals. The reference PSA concentration reported by the vendor in the prostate cancer serum was 10.1 ng/ml, which was close to our corrected measurement. The precision of our measurements, reported as the percent coefficient of variation (%CV) within a dilution series, ranged from 5.6 to 8.8 %, and the reproducibility, reported as the inter-assay %CV, ranged from 7 to 14.3 %. All of the values we report represent the average of three replicates.

10 Supplemental References 1. Evans, T. C., Jr., Benner, J. & Xu, M. Q. The in vitro ligation of bacterially expressed proteins using an intein from Methanobacterium thermoautotrophicum. J Biol Chem 274, (1999). 2. Watanabe, T. et al. The roles of the C-terminal domain and type III domains of chitinase A1 from Bacillus circulans WL-12 in chitin degradation. J Bacteriol 176, (1994).