Appendix A from C. Meunier et al., Multilevel Selection in the Filamentous Ascomycete Neurospora tetrasperma (Am. Nat., vol. 191, no. 3, p.

Transcription

1 Appendix A from C. Meunier et al., Multilevel Selection in the Table A: Strains of Neurospora tetrasperma used in the study Strain ID b Lineage a Heterokaryon Homokaryon Mating type L P4492 FGSC 9033 mat A FGSC 9034 mat a L6 P58 FGSC 2508 mat A FGSC 2509 mat a L0 UK33 FGSC 0707 mat A FGSC 0708 mat a UK4 FGSC 075 mat A FGSC 076 mat a a Phylogenetic lineages defined in Menkis et al. (2009) and Corcoran et al. (204). b IDs are Fungal Genetics Stock Center (FGSC), Perkins (P), or UK numbers (from Corcoran et al. 202). The two homokaryotic, single mating-type component strains are isolated from the listed heterokaryon.

2 Appendix B from C. Meunier et al., Multilevel Selection in the Table B: Number of replicates for each combination of treatments Ascospore () a 50% initial mat A ratio b 0% initial mat A ratio c Conidia (0 5 ) a 50% initial mat A ratio c 90% initial mat A ratio c Medium N: Harvesting time T: d Lineage L Lineage L Lineage L Harvesting time T2: d Lineage L Lineage L Lineage L Medium low N: Harvesting time T: d Lineage L e 5 7/0 7/0 8/0 Lineage L Lineage L Harvesting time T2: d Lineage L e 6 8/2 8/3 8/ Lineage L Lineage L a Initial number per plate as inoculum. b Goes through a stage. c Setup described in appendix E. d T and T2 indicates two different development times. T corresponds to 2 or 3 days of growth (all plates at a vegetative state) and T2 to 7 or 8 days of growth (all plates engaged in sexual reproduction; see the main text). e When two numbers are given for medium low N, they indicate replicates grown on synthetic cross medium/modified Vogel. One number indicates only modified Vogel.

3 Appendix C from C. Meunier et al., Multilevel Selection in the Table C: Primer sequences (5 0 to 3 0 ) for allele-specific qpcrs mat A targeted nucleus mat a targeted nucleus Lineage L: Targeted gene ad-9 mat a- Forward primer GTAGGTCATTGGACGAGGGGTT ATTGGGAATTATGCTTCTTGGTCCC Reverse primer GTCTTGTTGTTCTCCAGCTTTCCAG TCTCACGATGATGGTTCTTACGGTA Fragment size (pb) Annealing temperature (7C) 6 6 Lineage L6: Targeted gene lys-4 mat a- Forward primer AATTCGGTCTCACTCCCAGC ATTGGGAATTATGCTTCTTGGTCCC Reverse primer GGGACTCCATGTTCACTGGT TCTCACGATGATGGTTCTTACGGTA Fragment size (pb) Annealing temperature (7C) Lineage L0: Targeted gene mat A- mat a- Forward primer TGTCATCGCCAAGCTTTCAG ATGCACCGGCTTTCAACTTC Reverse primer AACATCGCCGAAACTCCAAC TGAACGAAATCCAGGTGTGG Fragment size (pb) Annealing temperature (7C) Note: qpcr p quantitative polymerase chain reaction.

4 Appendix D from C. Meunier et al., Multilevel Selection in the Accuracy of the qpcr Method for the Estimation of Nuclear Ratio To test for the accuracy of the qpcr method in determining nuclear ratios, we investigated the recovery of known DNA proportions in samples prepared as follows: DNA was extracted from single mating-type component strains, and the concentrations of each DNA sample were estimated with NanoDrop (Thermo Scientific), after which we mixed DNA of mat A and mat a nuclei to build nuclear ratios ranging from 0% to 90% of each nuclear type and measured the ratio in these mixed samples by our qpcr method. The correlation between the ratios obtained by the two methods was highly significant, with a slope of.009 and an R 2 of Detailed results for each lineage are given in figure D. Furthermore, we tested the accuracy of our estimation method by replicating qpcr measurements on the same DNA samples and estimated the technical variance of the result for each DNA sample (see also fig. F2). Our results showed that the technical variances ranged between 2% and 0% in the different lineages (table ). Overlapping confidence intervals for the technical variances among initial ratios (fig. D2) showed that the technical variance did not depend on the initial ratio in the inoculum. However, the variance differed among lineages, showing a slightly less accurate estimation of nuclear ratios in L0 (mean [L], 0.00 [L0], and [L6]; fig. F2). Taken together, these analyses showed a high reproducibility in measuring nuclear ratio with our qpcr method.

5 Appendix D from C. Meunier et al., Multilevel Selection in the Filamentous Ascomycete Neurospora tetrasperma Accuracy of qpcr.2. L: Adj R2 = Slope = 0.96 P =.73e 2 L0: Adj R2 = Slope =.0 P = 4.45e 45 L6: Adj R2 = Slope =.05 P = 6.59e 25.0 Proportion of mat A: qpcr estimates Lineage L L0 L Proportion of mat A: DNA mixes Figure D: Accuracy of the qpcr method used in the estimation of nuclear ratios. The Y-axis shows the estimates of nuclear ratio obtained by qpcr, while the X-axis shows the proportions of mixed DNA samples for which the concentration of DNA from mat A and mat a homokaryons was measured separately using NanoDrop before mixing. The correlation of the qpcr estimation and the mixed proportions is shown for each lineage. 2

6 Appendix D from C. Meunier et al., Multilevel Selection in the Filamentous Ascomycete Neurospora tetrasperma Sector vs. technical variance in nuclear ratio by initial ratio and lineage L L0 L Variance in nuclear ratio % mat A 50% mat A 0% mat A 90% mat A 50% mat A 0% mat A 90% mat A 50% mat A 0% mat A Initial inoculum Mean sector variance Mean technical variance Figure D2: Sector and technical variance in nuclear ratio, shown by lineage and initial ratio. For the sector variance (orange), each dot represents the variance in nuclear ratios among sectors of a single plate. For the technical variance (black), each filled circle represents the variance in nuclear ratio among five qpcr replicates of the same sample (i.e., the same DNA extract). The experimental design is presented in figure F. Bars indicate the 95% confidence interval on the mean (sector and technical) variance for each lineage. 3

7 Appendix E from C. Meunier et al., Multilevel Selection in the Evaluation of Conidia Inoculum: Initial Nuclear Ratios, Germination Rate, and Hyphal Fusion First, we investigated whether conidia mixes, aimed to generate mycelia with manipulated nuclear ratios, reflected the expected initial ratios of nuclei (90%, 50%, or 0% mat A nuclei) at the onset of growth. We compared the genetic content of our inocula, as estimated by qpcr, with the result from the method of counting conidia of different mating type. Differences between these estimates are expected if conidia containing different nuclear types differ in number and/or distribution of nuclei in the spores. In L, the ratios estimated by conidia counting and qpcr were in accordance, while we found some small but significant deviations between qpcr estimations and conidia countings in L6 and L0 (table E). In L6, qpcr estimations show that the nuclear ratio was significantly more even than indicated by our counting method, and in L0, the 90% and 50% mat A inoculum showed significantly less DNA from mat A nuclei than aimed for in our counting method (table E). Second, to investigate the germination rates of conidia of differing mating types, we plated mat A and mat a conidia in the same number on different petri dishes with sorbose medium and recorded their relative germination rate by counting colonies of each type after 2 days. For L6, we found a bias in germination rate favoring mat A nuclei, while in L0, a bias in germination rate for conidia containing mat a nuclei was found (table E). We give in table E the theoretical prediction of initial ratios in the inoculum after germination, taking nuclear content in conidia and germination biases into account. Taken together, our verifications revealed that at the onset of growth, the nuclear ratio in the inocula were not exactly as aimed for but consistent with the proportions we were aiming at. Thus, for each lineage, growth was initiated from three highly different initial nuclear ratios. The starting points were also comparable among lineages, allowing us to compare the dynamics of nuclear ratios among them. Finally, we verified hyphal fusion after germination in the conidia inoculum. We expect conidia to fuse right after germination to build a single individual mycelium (Roca et al. 2005), provided they display identical alleles at so-called het (for heterokaryon incompatibility) genes (Zhao et al. 205). Previous studies have shown that the nuclei of the heterokaryons investigated herein harbor the same het alleles at two investigated het loci (Corcoran et al. 206). Thus, we expect conidia from opposite mating types of the same lineage to fuse and build one single heterokaryotic individual. We verified these expectations experimentally by isolating single hyphae growing from the conidia inoculum, transferring them to new plates, and verifying their self-fertility. If fusion would not occur, we expected single hyphae growing from homokaryotic conidia to remain homokaryotic and self-sterile. If fusion occurred, we expected hyphae germinating from homokaryotic conidia to fuse irrespective of mating type and to result in heterokaryotic, self-fertile mycelia. Single hyphae gave rise to self-fertile heterokaryons (data not shown), and hence we concluded that the fungus grows as heterokaryotic after the fusion of conidia of opposite mating type. Table E: Verification of the nuclear content of conidia inocula and germination rates Lineage and inoculum setup: counting method (% mat A) Inoculum estimated by qpcr (% mat A) Germination rate b (mat A/mat a) Theoretical nuclear ratio after germination c (% mat A) L: (88 94) na na (50 60) (9 4) L6: (84 87) a (50 5) (2 4) a... L0: (84 86) a (39 45) a (9 0)... 5 Note: na p not applicable; qpcr p quantitative polymerase chain reaction. a qpcr significantly different than aimed at. b Germination rate was not estimated for L, as observed ratios during growth were close to initial inoculum ratios (see fig. 3A). c Computed nuclear ratio taking into account the qpcr estimates and biases in germination rates.

8 Appendix F from C. Meunier et al., Multilevel Selection in the Homogeneity of Nuclear Ratio in the Mycelium We compared the variance in nuclear ratios over different parts of the same mycelium with the technical variance of qpcr in estimating nuclear ratios. A larger sector variance as compared to technical variance would imply that different parts of the mycelium harbor different, heterogeneous nuclear ratios, whereas comparable sector and technical variances indicate homogeneity in nuclear ratios in the mycelium. Figure F describes the experimental design of the experiment. Figure F2 shows that sector variance was not larger than technical variance, thus indicating homogeneity of nuclear ratios throughout the mycelium. Figure F: Experimental design for the assessment of sector variance and technical variance. Inocula consisting of 0 5 conidia with 90%, 50%, or 0% mat A nuclei were deposited onto the center of petri dishes with medium N. For each inoculum ratio, we inoculated three replicate plates. For each plate, eight sectors of the outgrown mycelia were delimited and tissue from four of these (as indicated with numbers 4) were harvested andanalyzed for nuclearratio using qpcr. The variance among the estimated nuclear ratios from these foursectorsof each plate is he sectorial, or individual, variance (orange). For the assessment of technical variance, the DNA extracted from each of four sectors of one plate per ratio was analyzed five times by qpcr. The variance among the estimated nuclear ratios from this same DNA sample is the technical variance (black).

9 Appendix F from C. Meunier et al., Multilevel Selection in the Filamentous Ascomycete Neurospora tetrasperma Sector vs. technical variance in nuclear ratio by lineage Variance in nuclear ratio L L0 L6 Lineage Variance among sectors Technical Variance Figure F2: Sector variance versus technical variance in nuclear ratio, shown by lineage. Sector variance (orange): each dot represents the variance in nuclear ratios among sectors on a single plate. Technical variance (black): each filled circle represents the variance in nuclear ratio among five qpcr replicates of the same sample (i.e., the same DNA extract). The experimental design is presented in figure F. Bars are the 95% confidence interval on the mean (technical or sector) variance by lineage. 2

10 Appendix G from C. Meunier et al., Multilevel Selection in the Proportion of mat A Nuclei in Mycelia of Additional L0 Strains In lineage L0, we estimated nuclear ratios in strain UK4 (homokaryons FGSC 075 and 076) in addition to strain UK33, for which results are presented in the main text and figures. Boxplots of observed nuclear ratios in inoculum and outgrown mycelia in the additional strain are shown in figure G. Lineage 0: strain FGSC075/6 Initial conidia ratios 90% mat A 50% mat A 0% mat A Proportion of mat A Medium N (asex) Medium low N (sex) Inoculum T0 T T2 T0 T T2 T0 T T2 Time Point Figure G: Proportion of mat A nuclei in lineage 0, strain UK4. Mycelia were inoculated with conidia mixed in different proportions of mating types. Nuclear ratios were estimated in the inoculum and in outgrown mycelia. Data are shown by aimed proportion of mat A in the mixes of conidia (90%, 50%, and 0% mat A nuclei), by medium, and by duration of growth. T is 2 days after inoculation, and T2 is 7 days after inoculation. Bars represent the 95% confidence intervals on the median of the nuclear ratios for each treatment.

11 Appendix H from C. Meunier et al., Multilevel Selection in the Table H: Results of ANOVA for the effect of sample type (mycelium or conidia) on the nuclear ratio in L0 Conidia vs. mycelium nuclear ratios df F P L0 plate L0 plate L0 plate

12 Appendix I from C. Meunier et al., Multilevel Selection in the Ascospore Production of Fertilized Mycelia Grown as Homokaryons Until Mating Homokaryons of both mating type were grown for 0 days, until full development of sexual structures, and then crossed with the opposite mating type of the same lineage. The same number of opposite mating type conidia were added on the mycelia, and ascospore production was then monitored as described for heterokaryons in Material and Methods. Homokaryons grown in isolation invest in female reproductive protostructure ( protoperithecia; see also fig. 6A). Ascospore yield then depends on investment into the female role and on the fertilization success. Figure I shows ascospore yields that are different depending on which mating type was grown in isolation and subsequently fertilized. Yields can thus be considered to measure reproductive fitness of mycelia early growing as homokaryons as opposed to early growing as heterokaryons (cf. fig. 6B). Ascospore production by fertilized homokaryons L L0 L6 Log of Ascospores Concentration 2 0 mat A mat a mat A mat a mat A mat a Resident homokaryon before mating Figure I: Ascospore production by fertilized homokaryons. Boxplots of the logarithm of ascospore production as a function of the resident homokaryons mating type. Bars are 95% confidence intervals on the median of the log (ascospore concentration), and dots are outliers.