SUPPLEMENTAL MATERIAL FOR. Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important

Transcription

1 SUPPLEMENTAL MATERIAL FOR Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important for Commitment to Sporulation during Myxococcus xanthus Development Ramya Rajagopalan and Lee Kroos # Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI USA 1

2 Table S1. Bacterial strains, plasmids, and primers Bacterial strain, Description Source or reference plasmid, or primer M. xanthus strains DK1622 Wild type (1) DK5217 sgla1 bsga::tc r (2) DK5209 bsga::tc r ; Mx8 clp2 transduction L. Kroos and D. Kaiser from DK5217 into DK1622 SW2808 ΔmrpC (3) DK5285 frua::tn5 lac Ω4491 (4) Plasmid pcr2.1-topo Ap r Km r laczα Invitrogen prr010 pcr2.1-topo with 110 bp internal This work fragment of mrpc Primer mrpc qpcr F GGAGGCCATCGACTTCAAGG This work mrpc qpcr R GGCCGGACTTCAGCAGGTAG This work Pdev-T-F TCCGAGCAGTCTTGAGCAGC This work Pdev-T-R GGTGATGTTTCCCTCGGTGAG This work 16S rrna fwd CAAGGGAACTGAGAGACAGG (5) 16S rrna rev CTCTAGAGATCCACTACTTGCG (5) 2

3 (p)ppgpp starvation MrpB P EBPs A signal MrpA MrpB mrpa mrpb mrpc nutrient addition proteolysis MrpC MrpC Esp STPKs act BsgA MrpC P Act csga MrpC2 CsgA frua C signal FruA cellular lysis FruA* dev aggregation DevT sporulation FIG S1 Model of the M. xanthus regulatory network and scanning electron micrographs of fruiting body development. Starvation triggers a cascade of enhancer-binding proteins (EBPs) (6) and an increase in intracellular (p)ppgpp (7, 8) and extracellular A-signal (9, 10), causing induction of the mrpab operon (11) and the act operon (6, 12). MrpA is a putative histidine protein kinase/phosphatase thought to influence phosphorylation of MrpB, a putative EBP hypothesized to activate mrpc transcription (3). Other mechanisms linking MrpC activity to starvation include the Esp signaling system (13) and two serine/threonine protein kinases (STPKs) that govern phosphorylation of MrpC (14). MrpC is converted to an N-terminallytruncated form, MrpC2, in a process that requires BsgA and is inhibited by phosphorylation of MrpC (15, 16). It has been reported that MrpC positively autoregulates and positively regulates mrpab (3), and that MrpC2 binds to sites in the mrpc and frua promoter regions with higher affinity than MrpC (15), but for simplicity only MrpC is depicted to positively autoregulate and positively regulate mrpab, and only MrpC2 is depicted to activate transcription of frua (16) and the dev operon (A. Campbell, P. Viswanathan, B. Son, T. Barrett, and L. Kroos, unpublished 3

4 data), and stimulate production of C-signal (11). The red stop sign and arrows highlight the major finding of this work, that nutrient addition stimulates proteolysis of MrpC, halting expression of the dev operon, whose products are important for commitment to sporulation. If starvation persists, positive feedback loops, including several involving MrpC (mentioned above), C-signal, and activated FruA (FruA*) that are highlighted by green arrows, may ensure that cells in nascent fruiting bodies commit to forming spores. C-signaling is increased by two positive feedback loops. First, it changes motility to promote cell alignment during aggregation (17-19), which enhances C-signaling (2, 20-22). Second, it activates FruA (23), which in turn stimulates the act operon (12) whose products enhance csga transcription leading to C-signal production (24). FruA* is also part of another positive feedback loop, since together with MrpC2 it activates the dev operon (25) (A. Campbell, P. Viswanathan, B. Son, T. Barrett, and L. Kroos, unpublished data), which codes for a protein, DevT, that positively regulates frua transcription (26). Scanning electron micrographs from (27) are reprinted with permission and show rod-shaped cells aggregating to form a fruiting body inside which cells differentiate into spherical spores. 4

5 A Protein (μg/μl) Hours after Starvation B Replacement: 0.30 None Starvation Nutrient 0.25 Protein (μg/μl) S-24 18S-36 24S-30 24S-36 24S-48 30S-36 30S-42 30S-48 18N-24 18N-36 24N-30 24N-36 24N-48 30N-36 30N-42 30N-48 Hours after starvation FIG S2 Effect of nutrient addition on the total protein concentration during development. (A) Protein concentration during development of M. xanthus DK1622 in submerged culture. Cultures were harvested at the indicated times and the total protein concentration was measured. (B) Effect of nutrient addition. Cells undergoing development as in panel A were either left undisturbed or the culture supernatant was replaced with fresh starvation buffer (designated S ) or nutrient medium (designated N ) at 18, 24, or 30 h. Cultures were harvested and the total protein concentration was measured at the indicated times (e.g., 24N-36 means the culture supernatant was replaced with nutrient medium at 24 h and the culture was harvested at 36 h). In both panels, values are the average of at least three biological replicates and error bars represent 1 standard deviation from the mean. 5

6 A B Wild type mrpc Wild type mrpc frua bsga frua bsga C 18 h S N S+Cm t 1/2, min N = 25 S+Cm = 55 FIG S3 Fruiting body formation (A) and cellular shape change (B) are hindered in mrpc (SW2808), frua (DK5285), and bsga (DK5209) mutants compared to wild-type M. xanthus DK1622 under submerged culture conditions. Photos were taken at 30 h post-starvation. Representative images are shown in panels A (Bar = 100 m) and B (Bar = 5 m). Arrows indicate thickened rods or ovoid spores. Similar results were observed in at least two biological replicates. (C) Effect of nutrient addition on the MrpC level during development of the bsga mutant. M. xanthus DK5209 was starved under submerged culture conditions for 18 h, then the culture supernatant was replaced with fresh starvation buffer (S), nutrient medium (N), or fresh starvation buffer with 200 μg/ml chloramphenicol (S+Cm). At the indicated times (in h) after replacement, cultures were harvested and equal amounts of protein were analyzed by immunoblot using anti-mrpc antibodies. A representative immunoblot is shown. Arrowhead indicates MrpC. The half-life in minutes (t 1 2, min) of MrpC after the indicated treatment is shown to the right. A similar ratio of the half-life after nutrient treatment to that after chloramphenicol treatment was observed in at least two biological replicates. 6

7 A S N S+Cm 18 h N = 125 S+Cm = 130 B S N S+Cm N+Cm 24 h N = 85 S+Cm = 50 N+Cm = 55 FIG S4 Effect of nutrient addition on the FruA level during development. M. xanthus DK1622 was starved under submerged culture conditions and after 18 h (A) or 24 h (B) the culture supernatant was replaced with fresh starvation buffer (S), nutrient medium (N), fresh starvation buffer with 200 μg/ml chloramphenicol (S+Cm), or nutrient medium with 200 μg/ml chloramphenicol (N+Cm). At the indicated times (in h) after replacement, cultures were harvested and equal amounts of protein were analyzed by immunoblot using anti-frua antibodies. Representative immunoblots are shown. The half-life in minutes (t 1 2, min) of FruA after the indicated treatment is shown to the right. A similar ratio of the half-life after nutrient treatment to that after chloramphenicol treatment was observed in at least two biological replicates. 7

8 S(-) S+PIC S+EDTA t 1/2, min S+PIC = 60 S+EDTA = 45 N(-) N+PIC N+EDTA N+PIC = 70 N+EDTA = 90 N+Pefabloc N+Aprotinin N+Leupeptin N+E-64 N+Pepstatin N+Apyrase FIG S5 Effects of nutrient addition and protease inhibitors on degradation of MrpC in extracts of developing cells. M. xanthus DK1622 was starved under submerged culture conditions and after 24 h the culture supernatant was replaced with fresh starvation buffer (S) or nutrient medium (N) for 15 min. Cultures were harvested and protease inhibitor(s) was added prior to sonication, or no protease inhibitor was added as a control (-). After sonication, samples were taken at the indicated times (in min). Apyrase was added immediately after sonication. Equal sample volumes were analyzed by immunoblot using anti-mrpc antibodies. Gaps in the image indicate samples analyzed on separate immunoblots. Representative immunoblots are shown. The half-life in minutes (t 1 2, min) of MrpC under the indicated condition is shown to the right. A similar ratio of the half-life in the presence of PIC to that with EDTA was observed in at least two biological replicates. 8

9 A MrpC S S+EDTA B MrpC N N+EDTA N+Apyrase C MrpC2 N N+EDTA N+Apyrase FIG S6 Effects of nutrient addition, EDTA, and apyrase on degradation of purified recombinant His 10 -MrpC (A and B) or His 10 -MrpC2 (C) by extracts from developing cells. M. xanthus DK1622 was starved under submerged culture conditions and after 24 h the culture supernatant was replaced with fresh starvation buffer (S) or nutrient medium (N) for 15 min. Cultures were harvested and sonicated with no addition or with EDTA as indicated. Apyrase was added to one set of samples after sonication. Undiluted extract or extract from a 2-fold dilution series (indicated by a triangle representing a decreasing concentration of extract from left to right) was incubated with equal amounts of His 10 -MrpC or His 10 -MrpC2 for 10 min, then equal volumes were analyzed by immunoblot using anti-mrpc antibodies. Gaps in the image indicate samples analyzed on separate immunoblots or removal of intervening lanes from an immunoblot. Representative immunoblots are shown. Similar results were observed in at least two biological replicates. 9

10 A B S(-) S+PIC S+EDTA t 1/2, min S+PIC = 125 S+EDTA = 70 N(-) N+PIC N+EDTA N+Apyrase t 1/2, min N+PIC = 130 N+EDTA = 110 S(-) 0 S+PIC S+EDTA t 1/2, min S+PIC = 110 S+EDTA = 60 N(-) N+PIC N+EDTA N+Apyrase t 1/2, min N+PIC = 125 N+EDTA = 100 FIG S7 Effects of nutrient addition and protease inhibitors on degradation of FruA in extracts of developing cells. M. xanthus DK1622 was starved under submerged culture conditions and after 18 h (A) or 24 h (B) the culture supernatant was replaced with fresh starvation buffer (S) or nutrient medium (N) for 15 min. Cultures were harvested and protease inhibitor(s) was added prior to sonication, or no protease inhibitor was added as a control (-). After sonication, samples were taken at the indicated times (in min). Apyrase was added immediately after sonication. Equal sample volumes were analyzed by immunoblot using anti-frua antibodies. Gaps in the image indicate samples analyzed on separate blots. Representative immunoblots are shown. The half-life in minutes (t 1 2, min) of FruA under the indicated condition is shown to the right. A similar ratio of the half-life in the presence of PIC to that with EDTA was observed in at least two biological replicates. 10

11 References 1. Kaiser D Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 76: Kroos L, Kaiser D Expression of many developmentally regulated genes in Myxococcus depends on a sequence of cell interactions. Genes Dev. 1: Sun H, Shi W Genetic studies of mrp, a locus essential for cellular aggregation and sporulation of Myxococcus xanthus. J. Bacteriol. 183: Kroos L, Kuspa A, Kaiser D Defects in fruiting body development caused by Tn5 lac insertions in Myxococcus xanthus. J. Bacteriol. 172: Ossa F, Diodati ME, Caberoy NB, Giglio KM, Edmonds M, Singer M, Garza AG The Myxococcus xanthus Nla4 protein is important for expression of stringent responseassociated genes, ppgpp accumulation, and fruiting body development. J. Bacteriol. 189: Giglio KM, Caberoy N, Suen G, Kaiser D, Garza AG A cascade of coregulating enhancer binding proteins initiates and propagates a multicellular developmental program. Proc. Natl. Acad. Sci. USA 108:E431-E Manoil C, Kaiser D Accumulation of guanosine tetraphosphate and guanosine pentaphosphate in Myxococcus xanthus during starvation and myxospore formation. J. Bacteriol. 141: Manoil C, Kaiser D Guanosine pentaphosphate and guanosine tetraphosphate accumulation and induction of Myxococcus xanthus fruiting body development. J. Bacteriol. 141: Kuspa A, Plamann L, Kaiser D Identification of heat-stable A-factor from Myxococcus xanthus. J. Bacteriol. 174: Plamann L, Kuspa A, Kaiser D Proteins that rescue A-signal-defective mutants of Myxococcus xanthus. J. Bacteriol. 174: Sun H, Shi W Analyses of mrp genes during Myxococcus xanthus development. J. Bacteriol. 183: Gronewold TM, Kaiser D Mutations of the act promoter in Myxococcus xanthus. J. Bacteriol. 189: Higgs PI, Jagadeesan S, Mann P, Zusman DR EspA, an orphan hybrid histidine protein kinase, regulates the timing of expression of key developmental proteins of Myxococcus xanthus. J. Bacteriol. 190: Nariya H, Inouye S Identification of a protein Ser/Thr kinase cascade that regulates essential transcriptional activators in Myxococcus xanthus development. Mol. Microbiol. 58: Nariya H, Inouye S A protein Ser/Thr kinase cascade negatively regulates the DNAbinding activity of MrpC, a smaller form of which may be necessary for the Myxococcus xanthus development. Mol. Microbiol. 60: Ueki T, Inouye S Identification of an activator protein required for the induction of frua, a gene essential for fruiting body development in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 100: Jelsbak L, Sogaard-Andersen L The cell surface-associated intercellular C-signal induces behavioral changes in individual Myxococcus xanthus cells during fruiting body morphogenesis. Proc. Natl. Acad. Sci. USA 96:

12 18. Jelsbak L, Sogaard-Andersen L Pattern formation by a cell surface-associated morphogen in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 99: Sogaard-Andersen L, Kaiser D C factor, a cell-surface-associated intercellular signaling protein, stimulates the cytoplasmic Frz signal transduction system in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 93: Kim SK, Kaiser D Cell motility is required for the transmission of C-factor, an intercellular signal that coordinates fruiting body morphogenesis of Myxococcus xanthus. Genes Dev. 4: Kim SK, Kaiser D Cell alignment required in differentiation of Myxococcus xanthus. Science 249: Kroos L, Hartzell P, Stephens K, Kaiser D A link between cell movement and gene expression argues that motility is required for cell-cell signaling during fruiting body development. Genes Dev. 2: Ellehauge E, Norregaard-Madsen M, Sogaard-Andersen L The FruA signal transduction protein provides a checkpoint for the temporal co-ordination of intercellular signals in Myxococcus xanthus development. Mol. Microbiol. 30: Gronewold TM, Kaiser D The act operon controls the level and time of C-signal production for Myxococcus xanthus development. Mol. Microbiol. 40: Viswanathan P, Ueki T, Inouye S, Kroos L Combinatorial regulation of genes essential for Myxococcus xanthus development involves a response regulator and a LysRtype regulator. Proc. Natl. Acad. Sci. USA 104: Boysen A, Ellehauge E, Julien B, Sogaard-Andersen L The DevT protein stimulates synthesis of FruA, a signal transduction protein required for fruiting body morphogenesis in Myxococcus xanthus. J. Bacteriol. 184: Kuner JM, Kaiser D Fruiting body morphogenesis in submerged cultures of Myxococcus xanthus. J. Bacteriol. 151: