Solutions to Problem Set 3

Transcription

1 Solutions to Problem Set 3 Stardate Personal Log of Chief Medical Officer on the USS Hackerprise Upon return from a mission to Europa, your fellow crew member, Noslen, becomes very ill. You screen Noslen for signs of infection and find that he is harboring an alien virus. Question 1 a) You discover that this virus carries nucleic acids, proteins and lipids. You also find that this virus can infect E. coli cells making it easy to study in the laboratory. i) You grow this virus with one of the following radioisotopes: 32 P, 3 H, or 35 S. Which of the viral macromolecules will be labeled with 32 P? nucleic acids Which of the viral macromolecules will be labeled with 3 H? all Which of the viral macromolecules will be labeled with 35 S? proteins ii) You analyze the nucleic acid and find the following. Percentage A G T C U What nucleic acid is the virus carrying. Why? This virus is carrying double-stranded DNA as shown by the %A = %T, %C = %G. The trace of uracil is contaminating RNA. b) Because this is an alien virus, you want to determine which of the macromolecules (nucleic acids, proteins and lipids) is the hereditary material. Explain how you would do this? In a manner analogous to the Hershey-Chase experiment, you would infect cells with 32 P labeled virus. After a short amount of time, you would separate the virus particles from the cells and examine where the 32 P DNA is found in the progeny virus particles. You would repeat these steps using 35 S labeled virus. 1

2 Question 2 a) The Vulcan scientist Crixon examines DNA replication to determine if it is similar to DNA replication on earth. She constructs an in vitro system for DNA replication. i) What are four components she should include in her system? template DNA, primer, dntps, DNA polymerase, ligase helicase, topoisomerase, SSB protein ii) Prior to replication, all the template DNA is labeled with 15 N. Where is nitrogen found in DNA? Nitrogen is found in the bases of DNA. iii) She repeats the Meselson-Stahl experiments. On the diagram below, draw the results expected at each round for both conservative and semi-conservative replication. conservative 14 N 14 N 15 N 15 N round 1 round 2 template DNA semi-conservative 14 N 15 N 2

3 Question 2, continued b) You have invented a Nanoscopic Imager that allows you to examine an origin of DNA replication. The computer returns the following picture. From this origin, replication is occurring on both strands and the two forks are moving away from each other. GTTCC 5' 3' A 5' 3' 5' 3' C 5' 3' B GTTCC 3' 5' Okasaki fragments origin or replication i) Label the 3 and 5 ends of the five DNA strands shown. Indicate which particular strands are Okazaki fragments. ii) What enzyme is required at C in the diagram above? DNA ligase iii) To which site (A or B or both) can the primer, 5'-CAAGG-3' bind to initiate replication? B iv) For each site chosen (in iii), what is the direction of elongation (left or right) of the daughter DNA strand? Right v) For each site chosen (in iii), is DNA synthesis performed in a continuous or a discontinuous fashion relative to the nearest replication fork? continuous c) More human crew members on the USS Hackerprise began to feel sick from the viral infection. While pondering this medical crisis, you notice that none of the Vulcan crew members are ill. When you talk with Crixon, your Vulcan colleague, she is intrigued and gives you a sample of Vulcan cells. So, you decide to mix the virus with the Vulcan cells and follow the infection cycle in the Vulcan blood cells. When you analyze the Vulcan cells, you notice that Vulcan DNA is highly modified with methyl groups on certain bases, and there is a peculiar nuclease in Vulcan cells that disassembles regular, unmodified DNA. Can you propose a model to explain the Vulcan immunity? The Vulcan cells contain a endogenous nuclease, an enzyme that breaks down DNA. When the virus infects the cell and injects viral DNA, this nuclease destroys the viral DNA before it can be copied, transcribed, and translated. The Vulcan DNA is not harmed by this nuclease because the Vulcan DNA is modified in such a way that the nuclease can not bind and cleave. A similar mechanism is actually used in bacterial cells. Eco RI, a restriction enzyme found in E. coli, does not cut E. coli DNA because it is modified, but it will cut foreign DNA that enters the cell. 3

4 Question 3 Your preliminary characterization of this new virus is going well. You discover that this virus has 1 chromosome, and you pinpoint a segment of DNA that you believe gives the virus its ability to infect. Starfleet medical wants you to cut out that DNA segment and place it into a vector to send to the Medical Research Facility at Omega Prime. Shown below is a schematic of the desired viral gene fragment and some flanking DNA. 5' AGTACTTATCGCGCGGCCTATA TATAGTACAGTCGACCTTAGGCCT 3' Infectivity gene 3' TCATGAATAGCGCGCCGGATAT ATATCATGTCAGCTGGAATCCGGA 5' AfaI AfaI SalI a) Shown below are the set of restriction enzymes (Purves, pp ) present in your freezer. Listed next to the enzyme name is its sequence specificity (from 5 to 3 ) and an arrow marks the location where the enzyme cuts. i) Circle the enzyme(s) that CANNOT cut the DNA fragment shown above. Only Afa I and Sal I cut as shown above. ii) Place a check next to the enzyme(s) that leave blunt ends. iii) Star the enzyme(s) that would leave overhanging ends after cutting. Sna B I TAC GTA Afa I GT AC *Eco R I G AATTC *Sal I G TCGAC iv) What single enzyme could you use to remove the gene from the viral DNA? Afa I v) Which pair of different enzymes could you use? Afa I and Sal I 4

5 Question 3, continued b) You want to insert the fragment into the vector shown below. Sal I SnaB I Afa I vector i) What enzyme(s) would you use to cut out the desired fragment from viral DNA? 1) Afa I 2) both Afa I and Sal I together ii) What enzyme(s) would you use to cut the vector DNA? if used 1) in i above: Afa I (you could also use Afa I and Sna B I together or even just SnaB I, but this is not the best choice. See d) below.) if used 2) in i above: Afa I and Sal I c) Say you use a single enzyme to cut both the vector and the fragment. i) After ligation of the fragment and the vector, how many sites for that enzyme will the resulting DNA have? Two sites ii) How many possible DNA molecules can result from this kind of ligation? The insert is not symmetrical and has two possible orientations with respect to the vector. Therefore, you can have two different DNA molecules from such a ligation. d) You pass your wonderful instructions detailed above to a Ferengi Lab Technician. The Ferengi bungles the experiment and uses only the enzyme SnaB I cut the vector DNA, and uses only Afa I to cut the fragment from the viral DNA. He then ligates the cut fragment into the cut vector. i) Can you fix this mess by cutting the fragment back out with SnaB I? Explain why or why not. ii) Can you fix this mess by cutting the fragment back out with Afa I? Explain why or why not. You can not cut the fragment out of this vector with either Sna BI or Afa I. When the two blunt ends are joined, the resulting sequence is 5'...TACAC...3' 3'...ATGTG...5' 5

6 Question 4 Starfleet Medical finally receives your vector, but they are having a lot trouble transcribing the DNA vector with the fragment. In their reaction tube, they have the standard RNA synthesis buffer, the vector DNA with fragment, DNA polymerase, and the nucleotide triphosphates ATP, GTP, TTP, and CTP. a) You think, Of Course!, and immediately send them a package containing RNA polymerase and UTP which should allow them to successfully synthesize RNA from the DNA vector containing the fragment. b) You figure that the scientists at Starfleet Medical are meatheads, and will probably need the components to synthesize protein from the RNA that they can now finally make. What three major components do you need to send to Starfleet Medical so they can synthesize protein from the viral RNA? Ribosomes, trnas, amino acids (or charged trnas) c) Meanwhile, back on the USS Hackeprise, you develop a nucleotide analog called Ketracell Indigo which you use as a treatment against this virus. Ketracell Indigo fits into the catalytic center of the viral RNA polymerase and prevents the viral RNA Polymerase from binding DNA. What effect will Ketracell Indigo have on viral transcription? Ketracell Indigo will stop viral transcription that is ongoing, and prevent new viral transcription from occurring. d) Your Ferengi technician suggests using Furomytin. Furomytin is a molecule that looks like an amino acid-charged trna. It binds in the A site of ribosomes and causes premature termination of protein synthesis. Which do you believe is a better drug against this infection? Explain why. Ketracell Indigo is the preferred drug for this situation. Ketracell Indigo will stop only viral transcription because it is specific for viral RNA polymerase. (Many viruses have their own RNA polymerase, although some use host polymerase). Furomytin binds to ribosomes which are from the host cell. Furomytin interferes with both host and viral translation. And the epilogue to this story. Not only do you cure your crew members, but you have been recognized for saving half the lives on the USS Hackerprise. Starfleet awards you the Bashir Prize in Biology and Medicine, the highest scientific honor given, and a holiday is created in your name. Starfleet Science Academy gives you a professorship, where you continue to write problem sets to torture students at the Academy. You end up living long and prospering. The End. 6