Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Transcription

1 Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature. Samples were analyzed on a FACScan (Becton Dickinson). RT-PCR Primers used were LGR5 forward: 5 CTTGGCCCTGAACAAAATACA 3, LGR5 reverse: 5 AAGGGTTGCCTACAAATGCTT 3, FGF18 forward: 5 CCTGCACTTGCCTGTGTTTAC 3, FGF18 reverse: 5 CGGTTCATGCACAGGTAGAAT 3, Nr-CAM forward: 5 CCATCCACCATACCATTTCTG 3, Nr-CAM reverse: 5 TGCGTTTGCCAGTAAATATCC 3, c-myc forward: 5 CCCTTGCCGCATCCACG 3, c-myc reverse: 5 CGAGGTCATAGTTCCTGTTGGTG 3. Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al, 2008).

2 Legends to supplementary figures Fig S1 Conductin protein levels oscillate during the cell cycle. (A) Western blotting of lysates from DLD1 cells during progression through the cell cycle as indicated on top, analysed with antibodies against indicated proteins. (B) Western blotting with antibodies against indicated proteins of lysates from 293T arrested with aphidicolin (G1) or with nocodazole (Mitotic). (C) Western blotting with antibodies against conductin and β-actin of lysates from asynchronous SW480 cells at indicated time points after addition of cycloheximide. (D) Western blotting for conductin, cyclin B1 and β-actin in lysates from SW480 cells at indicated time points after release from G1 arrest in the presence or absence of the tankyrase inhibitor XAV939. XAV939 was added 6 hours before collection of each time point. (E) Western blotting for conductin, phosphorylated β-catenin and β-actin in lysates from SW480 cells stably transfected with control vector (psuper) or sirna against conductin (siconductin), at indicated times points after release from G1 arrest and progression to G2/M.

3 Fig S2 CDC20 induces degradation of conductin but not axin1 through a WD40 repeatdependent mechanism. (A) Schematic representation of human CDC20 protein and domains as well as of the N-159 mutant lacking the WD40 repeats used in this study. Below a model of the two mechanisms for CDC20-mediated degradation, via substrate targeting (up) or only activating (down) of APC/C complex are shown. (B) Western blotting with antibodies against indicated proteins in lysates from 293T cells co-transfected with Flag-Nek2 and increasing amounts of GFP-tagged CDC20 or a CDC20 mutant lacking the WD40 repeats (GFP-N-159). GFP vector was used to keep total amount of transfected DNA equal. Arrowheads show GFP- CDC20, GFP-N-159 and GFP. (C) Western blotting with indicated antibodies in lysates of 293T cells transfected with either GFP-conductin (left) or CFP-axin1 (right) together with increasing amounts of GFP-tagged CDC20. (D) Western blotting (WB) for GFP and Flag after immunoprecipitation (IP) with a GFP antibody from lysates of 293T cells co-transfected with Flag-conductin and GFP-CDC20 or GFP-N159. Arrowheads indicate GFP-CDC20 and GFP-N159 mutant. Flag-conductin in lysates is also shown in lower panel (INPUT). (E) Western blotting for endogenous conductin, CDC20 and β-actin in lysates of asynchronous HCT116 colon cancer cells transfected with sirna against CDC20 or control sirna (sigfp). (F) Relative luciferase activities in asynchronous HCT116 cells transfected with TOPFlash or FOPFlash reporters together with sirnas against CDC20 or GFP as a control. Error bars show standard error of the mean SEM from 2 independent experiments.

4

5