Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Transcription

1 Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase treatment. a. Results show flow cytometry analysis. Gates were as written above each histogram. Dotted lines show negative control staining. b. GFP + haematopoietic cells from E15.5 intestines were obtained after collagenase treatment. Splenic Dendritic cells (DCs) were obtained from the adult spleen upon liberase digestion. Results show flow cytometry analysis gated on embryonic GFP + CD4 +, GFP + CD11c + cells and adult CD11c + DCs. Dotted lines show negative control staining. c. E15.5 intestine cell suspensions were sorted according to GFP, CD4 and CD11c expression. Results show a Giemsa staining of GFP + CD4 + (left) and GFP + CD11c + (right). d. E17.5 intestines were fixed, whole mount stained and imaged by confocal microscopy. Left panel: CD4 (green) and CD11c (red). Results show the presence of both CD4 + and CD11c + cells in the PP primordium; Right panel: E17.5 Gdnf -/- intestines were stained for CD4 (green) and Ret (red). The use of Gdnf -/- mice allows the exclusion of the Ret signal that would be given by neural crest cells. As the PP primordia form, the frequency of Ret + cells decreases. 1

2 Supplementary Figure 2. CD11c-DTR/GFP expression in gut haematopoietic cells. a. Haematopoietic cells from E17.5 intestines were obtained after collagenase treatment. Results show flow cytometry analysis gated on embryonic haematopoietic cells of hcd2-dsred CD11c-DTR/GFP mice gated on DsRed + (left) and CD11c + cells (right). b. Pregnant hcd2- GFP female mice were treated with PBS (dark grey) or Diphtheria Toxin (DT) (light grey) from E14.5 to E17.5. Results show PP numbers at E18.5. PBS treated n=10; DT treated n=11. No ill effects were observed in the mothers or the embryos. c. Peyer s Patch in a E18.5 embryo from double transgenic mice hcd2-dsred CD11c-DTR/GFP. 2

3 Supplementary Figure 3. Ret, Ret co-receptor, GFLs and LTβ expression in the embryonic intestines. a. RT-PCRs of different intestine cell populations. Cells from E15.5 intestines were purified as in Fig.2a. Cell suspensions were cell sorted by flow cytometry for the different analyzed cell populations. Samples from different cell populations were normalized according to Hprt expression. b. FACS plot from E15.5 intestines indicating that the only appreciable population expressing Ret above background are the CD11c + cells. The frequency of Ret expressing cells in the anlagen lymph node is very low and the development of these structures in Ret -/- embryos is not compromised (data not shown). c. RT-PCR for Ltb expression in embryonic gut E15.5. Cell sorting and normalization were performed as in a. d. Results shown Flow cytometry analysis. Gates were as written above each histogram. Dotted lines show control staining using an hamster anti-cd3 antibody (2C11), revealed with the same anti-hamster antibody used for LTβ. 3

4 Supplementary Figure 4. Peyer s Patches structure in adult mutant mice. Intestines of mutant and WT litter mate controls were analysed using stereo microscopy and PP dissected. Frozen sections of PP were stained with CD19 (green) and TCRαβ (red), showing B cell and T cell areas respectively. a. PP from Ret 51/51 and WT litter mate control; b. PP from Gfra3 -/- and WT litter mate control. 4

5 Supplementary Figure 5. Peyer s Patches development in Gdnf and Gfra1 mutant embryos. E16.5 and E17.5 intestines from deficient or wild type litter mate controls were fixed and whole mount stained with monoclonal CD4 antibodies. Whole mount stainings were analysed by stereo and confocal microscopy for PP development. Confocal images of mid gut from WT and mutant embryos are shown. Grey: intestine structure; Green: CD4. Results show analysis of: a. Gdnf -/- embryos. Similar number of PP (~5) were found in Gdnf -/- and WT litter mate controls. WT n=4; Gdnf -/- n=3; two tailed t-test p=0.67. b. Gfra1 -/- embryos. Similar number of PP (~5) were found in Gfra1 -/- and WT litter mate controls. WT n=3; Gfra1 -/- n=3; two tailed t-test p=

6 Supplementary Figure 6. BrdU incorporation by ARTN induced haematopoietic cell aggregates. E15.5 GFP + intestines were cultured in vitro with agarose beads impregnated with ARTN recombinant protein. At 72 hours BrdU was added for 1 hour to the culture at a concentration of 10mM. After fixation samples were stained for: GFP (green) and BrdU (red) and analysed by confocal microscopy. The vast majority of GFP + cells were BrdU negative. 6

7 Confocal Microscopy and whole mount staining antibodies. Embryonic organs and frozen sections were stained using the following antibodies: anti-cd4 Alexa 647 (Serotec); anti-ret (361D5/2C42H1); anti-gfp Alexa 647 (Molecular Probes); anti-vcam1 (R&D Systems); anti-cd11c Alexa647 (Serotec); anti-brdu, BU1/75 (ICR1) (Oxford Biotech); anti-tcrβ, H (ebioscience); anti-cd19, MB19-1 (ebioscience); anti-goat IgG Alexa 594 (Molecular probes); anti-rat IgG Alexa 594 (Molecular probes); anti-rabbit IgG Alexa 594 (Molecular Probes). Flow cytometry. Cell suspensions were stained using the monoclonal antibodies listed bellow: Anti- TCRab, H (ebioscience); anti-cd3, 2C11 (ebioscience); anti-cd4, CT-CD4 (Caltag); anti- CD11c, N418 (ebioscience); anti-il7 Receptor a, A7R34 (ebioscience); anti-cd117 (c-kit), 2B8 (ebioscience); anti-cd45, 30-F11 (ebioscience); anti-cd19, 1D3 (BD Pharmingen); anti-cd8, CT- CD8a (Caltag); anti-cd45r (B220), RA3-6B2 (BD Pharmingen); anti-vcam1, 429 (ebioscience); anti- MHC II, M5/114; anti-dec205, NLDC-145; anti-cd11b, M1/70 (ebioscience); anti-gr-1, GR-1 (ebioscience), anti-nk1.1, PK136 (ebioscience); anti-ltb, BB.F6.F6.BF2 (BD Pharmingen), anti-ret (361D5/2C42H1), anti-hamster IgG (Caltag); Streptavidin APC (Molecular Probes). Propidium Iodide incorporation was performed after ethanol fixation of GFP + sorted cells. Flow cytometric analysis was done using a FACS Calibur (Becton-Dickinson); data analysis using Cell Quest software (Becton- Dickinson). 7

8 RT-PCR analysis. Cell suspensions were sorted on a MoFlo (Dako-Cytomation) sorter on the basis of different cell surface staining and GFP expression. Total RNA was purified using TRIzol reagent (Invitrogen) according to the manufacture instructions. Listed primers are sense and reverse respectively. Ret: ATGGGTGACCTCATCTCCTT and TCGTTCAGGAGGAATTCCAG; Artn: TTCTGGAGCCGAAAGCTATG and TGCACAAATGCGCAGTGTGT; Nrtn: TGCTATCTGTCTGGATGTGC and AGGGAGAAAGTTCTCGAAGC; Pspn: TCTTCAAGAGGCTTCTGTGG and TACCAGACTGTGCTGGGTAT; Gfra2: ACACCGAACTATGTGGACTC and GATAGATGTGCAGGTGGTGA; Gfra3: TCTCTGATAGACTGCAGGTG and GTCGTGAAGAGTACACAGCA; Gfra4: CAACTACCTGGACAACGTGA and GTCCACGGTTCATGTTCCTA; Hprt: TCCCTGGTTAAGCAGTACAG and GCTTTGTATTTGGCTTTTCC; Ltb: CGGATTCTACACCAGATCCA and TCCACAACAGGTGTGACTGT. Samples from different cell populations were normalized according to Hprt expression. Gene sequences were obtained from URL: Genetic nomenclature was used according to the International Committee Standardized Genetic Nomenclature for Mice (URL: 8

9 Supplementary Movie 1. Mobility of GFP cells in the wall of the gut (low magnification). This movie shows a time lapse sequence of E15.5 intestines. GFP + cells exhibit a remarkable, seemingly random motility, sometimes reaching 6µm/min. Time lapse images were taken for 25 minutes. Supplementary Movie 2. Mobility of GFP cells in the wall of the gut (high magnification). This movie shows a high magnification of the cell migration on the wall of the embryonic intestine E15.5, allowing precise cell tracking measurements (Fig.2b). Time lapse images were taken for 25 minutes. Supplementary Movie 3. 3-Dimensional reconstitution of a mid-gut section of E17.5. This sample was immunostained with anti-gfp (green) and anti-cd4 (red), the intestine structure is depicted in grey colour. This movie shows that the PP primordium is comprised of different subsets of haematopoietic cells, here represented in green (GFP + ) and yellow (GFP + CD4 + ). 9