SUPPLEMENTARY INFORMATION

Transcription

1 Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc L8 76 ccattgtcacactcca 8 CcAttGTcaCaCtCC Relative luciferase expression.. L3 L2 L 6 L7 L6 L 7 7 T m ( C) L8 8 Supplementary Figure a. LNA-mediated inhibition of microrna-22 function in Huh-7 cells. Upper panel. Nine LNA-modified DNA oligonucleotides (L- s) complementary to mir-22 (top, 3' to ', seed sequence marked in red) were synthesized as LNA/DNA mixmer oligonucleotides with a complete phosphorothioate backbone and with T m values ranging from 62 to 8 ºC by varying the number and positions of LNA substitutions in the s (LNA, uppercase, DNA, lowercase). Lower panel. Derepression of the Renilla luciferase mir-22 reporter construct harboring a perfect match target site in its 3 UTR is shown as a function of the T m values of different oligonucleotides L- after transfection at nm in mir-22 expressing Huh-7 cells. b Relative luciferase expression nm nm. mir-6b let-7a mir-9b Supplementary Figure b. microrna inhibition in HeLa cells using the highly LNA substituted design and the dual luciferase reporter system. Three s complementary to hsa-mir-6b, hsa-mir-9b and hsa-let-7a were synthesised with the same LNA substitution pattern as in in Supplementary Fig. a (mir-6b: -CaCtgTCagCaCtTT-3, mir-9b: -TgCatAGatTtGcAC-3, let-7a: -AcAacCTacTaCcTC-3, LNA, uppercase; DNA, lowercase, complete PS backbone). The luciferase reporter plasmids were constructed by cloning a perfect match target site for each mirna into the 3 UTR of Renilla luciferase gene. Shown is depression of the Renilla luciferase reporters after transfection of the s in HeLa cells at low nanomolar concentrations. The values have been normalized to., which equals luciferase expression of the control Renilla luciferase reporter without a microrna target site in the 3 UTR.. indicates luciferase level of each sensor plasmid without addition of.

2 Supplementary Figure 2 a HCV Spectrin Relative amount of HCV genomic RNA. conc. (nm) OMe L6 (2 -OMe). Mock Random b HCV Spectrin Relative amount of HCV genomic RNA. conc. (nm) Mock Random OMe, mm (LNA) (2 -OMe). Supplementary Figure 2. Inhibition of HCV replication in Huh-7 cells harboring the HCV replicon NNeo/C-B. Different oligonucleotides and a fully complementary 2'-O-methyl (2 -OMe) oligonucleotide (Jopling et al. Science 2; 39, 77-8) targeting mir-22 were transfected at concentrations ranging from. to nm and total RNA samples were extracted and subjected to northern blot analysis. a, Initial screen of the effect on HCV replication by three s with increasing melting temperatures (, T m = 7 ºC; L6, T m =74 ºC and, T m =8 ºC) compared to the 2 -OMe oligonucleotide. Shown is also a quantification of the northern blot bands normalized to Spectrin (n=). b, The HCV replication assays were repeated with the high-affinity and the fully complementary 2 -OMe oligonucleotide alongside a 2 -OMe random sequence control and an LNA mismatch control oligonucleotide. Displayed is an additional HCV northern blot and a graph with quantified values from the repeated experiments (mean and SEM, n=3-4). 2

3 Supplementary Figure 3 a b c duplex mir-22 mir-22 northern blot 2 2 Relative total plasma cholesterol (%) Fold derepression mrna (qrt-pcr) Aldoa Bckdk 2 2 d e f S/tRNA duplex mir antagomir Relative total plasma cholesterol (%) antagomir Fold derepression mrna (qrt-pcr) Aldoa Bckdk 2 antagomir Supplementary Figure 3. Antagonism of mir-22 in mice by s and antagomir. Panels a-c, Enhanced potency of the high-affinity in mice compared to the. C7BL/6J mice were treated with the s (3 % LNA, T m = 7 ºC) or ( % LNA, T m =8 ºC), respectively, with doses ranging from three intraperitoneal injections of to 2 followed by sacrifice 48 h after last dose. mir-22, target mrna expression and total plasma cholesterol levels were analysed. a, Northern blot hybridized with an LNA-modified DNA oligonucleotide probe for mir-22 shows efficient sequestration of mature mir-22 in a heteroduplex with the high-affinity at the dose level. b, Total plasma cholesterol measured in the same mice as in (a). c, Derepression of two direct mir-22 target mrnas, aldolase A (Aldoa) and branched chain ketoacid dehydrogenase kinase (Bckdk) as measured by real-time RT-PCR Panels d-f, Comparison of the high-affinity with antagomir (Krutzfeldt et al. 2; Nature 438: ) in silencing of mir-22 in mice. d, mir-22 levels in C7BL/6J mice after treatment with three intraperitoneal injections of unconjugated or cholesteryl-conjugated antagomir, respectively, at the indicated doses. Shown is a northern blot of liver RNA samples probed for mir-22. e, Total plasma cholesterol as measured in the same mice as in (d). f, Derepression of two direct mir-22 target mrnas, aldolase A (Aldoa) and branched chain ketoacid dehydrogenase kinase (Bckdk) as measured by real-time RT-PCR. 3

4 Supplementary Figure 4 a b mm (LNA) mm (LNA) 2 AST (U/l) ALT (U/l) Supplementary Figure 4. Lipid accumulation and plasma transaminase levels in hypercholesterolemic mice. a, Oil red O stained frozen liver sections of three treated (upper panel) and three treated (lower panel) hypercholesterolemic mice. Red staining indicates lipid accumulation in the liver sections. b, The alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels as measured in high fat diet-fed C7BL/6J female mice upon sacrifice immediately after the 6-week treatment period with intraperitoneally delivered or LNA mismatch control oligonucleotide at a dose of twice weekly compared to the levels of treated control mice (mean, SEM, n=4-). 4

5 Supplementary methods Determination of duplex melting temperatures The oligonucleotide:mir-22 duplexes were diluted to 3 µm in µl RNase-free H 2 and mixed with µl 2x T m -buffer (2 mm NaCl,.2 mm EDTA, 2 mm Naphosphate buffer, ph 7.). The solution was heated to 9 C for 3 min and then allowed to anneal at 2 C for 3 min. The duplex melting temperatures (T m ) were measured on a Lambda 4 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature was ramped up from 2 C to 9 C and then down again to 2 C, recording absorption at 26 nm. First derivative and the local maximums of both the melting and annealing were used to assess the duplex melting temperatures. Cell cultures, plasmids and transfections Reporter plasmids were constructed by cloning a perfectly matching full length target site in the 3 'UTR of Renilla luciferase in psicheck2 plasmid (Promega). A synthetic microrna DNA duplex with Not I and Xho I overhangs was ligated into corresponding sites in psicheck2. Relative Renilla luciferase derepression by different s was assessed in Huh-7 (for mir-22) or HeLa cells. psicheck2 without target was used as control, representing the fully derepressed value (normalized to one), whereas the sensor plasmid with the mirna target site was used as control for full repression by the mirna. Firefly luciferase was used to normalize all values. Oligonucleotides and reporter plasmids (7 ng) were transfected in 96-well plates in quadruplicates using Lipofectamine 2 (Invitrogen) according to the manufacturer's protocol. Cells were harvested 24 hours post transfection using passive

6 lysis buffer (PLB, Promega) and assayed for luciferase activity using the dual luciferase assay from Promega. Hepatitis C in vitro replication assay Dose-response experiments with the Huh-7 cells harboring the HCV replicon NNeo/C-B were carried out as described (Jopling et al. Science 2; 39, 77-8) with the following modifications: the oligonucleotides were delivered at indicated concentrations into cells in 6 cm dishes by Lipofectamine 2 according to the manufacturer s protocol. Cells were transferred into cm dishes 24 hours after transfection and harvested 48 hours post transfection. Total RNA samples ( micrograms per sample) were analyzed by Northern blotting. Spectrin mrna was detected with a random-primed 32 P-labeled DNA probe (EcoRI/NotI fragment of IMAGE:26246, Invitrogen). 6