SUPPORTING INFORMATION:

Transcription

1 SUPPORTING INFORMATION: Targeted m 6 A reader proteins to study epitranscriptomic regulation of single RNAs Simone Rauch, Chuan He,,, and Bryan C. Dickinson *, Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago IL Howard Hughes Medical Institute, The University of Chicago, Chicago, IL Department of Chemistry, University of Chicago, Chicago IL *Corresponding author. address: Dickinson@uchicago.edu (Bryan C. Dickinson) Dickinson et al., Targeted m6a reader proteins, S1

2 Table S1: All Plasmids used in this study. Cas13b plasmids: # Plasmid Name: Description: Benchling Link: Cmv d0 active PspCas13b X6scGnmdaSzWQvbHfBwC Cmv d0 dpspcas13b-ggs-nythdf1 EhcdVC5ME0OYyA9UJfVA Cmv d0 dpspcas13b-ggs-nythdf2( ) WwYoBoYpesVm1GctvqzO Cmv d0 dpspcas13b-ggs-nythdf1(1-100) 4IuLfdmD2rxyKOuUoD2E Cmv d0 dpspcas13b-ggs-nythdf1( ) Cmv d0 dpspcas13b-ggs-nythdf1( ) XZHJgFuhWuuN861cbKRU Cmv d0 dpspcas13b-ggs-sun *all Cas13b plasmids have Kan resistance plasmids: # Plasmid Name: Description: Benchling Link: hu6 promoter PspCas13b dual luciferase reporter 3 UTR 6PObIxex4v49EEx2nAo hu6 promoter PspCas13b KRAS TvbppwR96Q7QFc7W hu6 promoter PspCas13b KRAS 2 5Kx3WuHFLrldov9JCHKM hu6 promoter PspCas13b KRAS 3 STgJGVMHwggItLqEGWGv hu6 promoter PspCas13b KRAS 4 UMRBpa96BoQmgOILyLFk hu6 promoter PspCas13b PPIB 1 Jp6s98d6s1yIEPAyPaKi hu6 promoter PspCas13b PPIB 2 V6h64qrB3cGYAQDa3gVz hu6 promoter PspCas13b PPIB 3 DpK1iXHAPIIVLdldcKQF hu6 promoter PspCas13b PPIB 4 *all plasmids have Carb resistance Dickinson et al., Targeted m6a reader proteins, S2

3 Table S2: qpcr Primers. Gene Name: Forward: Reverse: GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA ACTB TCAGCAAGCAGGAGTATGAC AGCCATGCCAATCTCATCT KRAS TGGTGGCTGATGCTTTGA CACTGGATAGGGTTCTGTCTATTC PPIB AACGCAGGCAAAGACACCAACG TCTGTCTTGGTGCTCTCCACCT Fluciferase AGGTTACAACCGCCAAGAAGC ATGAGAATCTCGCGGATCTTG Dickinson et al., Targeted m6a reader proteins, S3

4 A n.s B Normalized luciferase n.s Fluc 1 Guide Guide Fluc 1 Figure S1: (A) Firefly luciferase mrna levels as measured by qpcr and (B) luciferase protein levels (n = 2) as measured by dual luciferase assay do not changes when HEK293T cells are transfected with a dcas13b fusion protein without an effector. Student s t-test; *P < 5. Dickinson et al., Targeted m6a reader proteins, S4

5 dcas13b-y1: dcas13b-y2: Cas13b (nuclease): * P value = 76 P value = 68 Fluc Guide Guide 1 Fluc Guide Guide 1 Fluc Guide Guide 1 Figure S2: dcas13b-ythdf fusion proteins induce an increased protein production or RNA knockdown on a dual luciferase reporter construct in HeLa cells. dcas13b-y1 (n = 2), dcas13b- Y2 (n = 4), Cas13b (n = 5). Student s t-test; *P < 5. Dickinson et al., Targeted m6a reader proteins, S5

6 A n.s n.s n.s P value = 65 Guide Guide K3 Guide K1 Guide K2 Guide K4 KRAS4b (NM_004985) mrna transcript map: K4 (468) K3 (1460) K2 (3880) K1 (4560) B guide position * n.s * *** Guide Guide P4 Guide P3 Guide P1 Guide P2 PPIB mrna (NM_000942) transcript map: P4 (513) P3 (667) P2 P1 (843) (949) guide position Figure S3: screen with dcas13b-ythdf2 by RTqPCR for (A) KRAS and (B) PPIB. RTqPCR quantification of knockdown by dcas13b-ythdf2 with s that target different sites of the transcript to identify the regions of most robust response. Any further experiments were conducted with the s showing the largest response (K4 and P2). Student s t-test; *P < 5 ***P < 01. Dickinson et al., Targeted m6a reader proteins, S6

7 Cas13b dcas13b-y2 A B beta actin beta actin CypB CypB : PPIB : PPIB Figure S4: Targeted dcas13b-y2 proteins induce protein level changes. (A) HEK293T cells were transfected with active Cas13b nuclease and either or PPIB and protein levels for the protein product of PPIB (cyclophilin B CypB) were assayed. (B) The same analysis as in A was performed but with dcas13b-y2. Dickinson et al., Targeted m6a reader proteins, S7

8 A Housekeeping Gene: B GAPDH ACTB Normalized PPIB expression n.s * -log10(pval) Fluc Fluc log2 (FoldChange vs NA) C Housekeeping Gene: GAPDH ACTB D 100 Normalized PPIB expression PPIB ** ** PPIB -log10(pval) log2 (FoldChange vs NA) Figure S5: On- versus off-targeting by dcas13b-y2 and Cas13b. (A) RT-qPCR analysis of dcas13b-y2 targeting PPIB RNA using two different validated housekeeping genes. This sample was subsequently sent for Illumina sequencing. (B) Volcano plot of differentially expressed transcripts between dcas13b-y2 and versus PPIB-targeting as determined by RNA sequencing (n = 3). (C) RT-qPCR analysis of Cas13b nuclease targeting PPIB RNA using two different validated housekeeping genes. (D) Same analysis for dcas13b targeting the endogenous PPIB transcript as shown in B. We find that both dcas13b-y2 and the active Cas13b nuclease show few differentially expressed transcripts (26 vs 23 significant transcripts shown in blue). The two PPIB isoforms (shown in red) knocked down by Cas13b barely fall into our confidence cutoff for significant transcripts. Transcripts knocked down with dcas13b-y2 do not show statistically significant changes. After we verified our dcas13b-y2 fusion by RT-qPCR with different housekeeping genes and by Western blot, we determined the extend of changes in transcript levels are likely responsible for this discrepancy. Further optimization to maximize the cellular response to our dcas13b-y2 construct could likely remedy this discrepancy in the future. Student s t-test; *P < 5 **P < 1. Dickinson et al., Targeted m6a reader proteins, S8