Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:

Transcription

1 Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate, strand? (The 5' and 3' are not specified. We know that. Apply the standard conventions for polarity.) a) ACGCGAGCGCTCTTCCAGCTTGAGCAGCATGAAG b) TGCGCTCGCGAGAAGGTCGAACTCGTCGTACTTC c) GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA d) CTTCATGCTGCTCAAGCTGGAAGAGCGCTCGCGT 2. (5 points) You have a piece of DNA that includes the sequence: 5' - GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT - 3' To amplify this DNA by PCR you would use a pair of primers containing which two of the following eight primers (you must get both primers right to get any credit -- circle two letters): a) 5' - GAAGAGGAGTAGGAGTAG - 3' b) 5' - CTTCTCCTCATCCTCATC - 3' c) 5' - GATGAGGATGAGGAGAAG- 3' d) 5' - CTACTCCTACTCCTCTTC - 3' e) 5' - CATCACAATATGTTCAGT- 3' f) 5' - GTAGTGTTATACAAGTCA- 3' g) 5' - TGACTTGTATAACACTAC- 3 h) 5' - ACTGAACATATTGTGATG- 3' 3. (6 points) During the elongation phase of DNA synthesis (after initiation) some proteins are involved in lagging strand synthesis, but are not involved in leading strand synthesis. ndicate which of the following are involved in only in lagging strand synthesis: a) DNA polymerase b) DNA polymerase c) primase d) DNA ligase e) topoisomerase f) DNA helicase 4. (5 points) Osteoporosis-pseudoglioma syndrome (OPPG) is an autosomal recessive disorder generally characterized by congenital or infancy-onset visual loss and skeletal fragility recognized during childhood. Mutations in the low-density lipoprotein receptor related protein 5 (encoded by LRP5) cause OPPG. OPPG is a rare disorder with an estimated population incidence of 1 per 2,000,000 [hint: use 1,960,000 for ease of calculation]. Heterozygous carriers of OPPG-causing mutations have reduced bone-mineral density (BMD). The population of the U.S. is 300 million. Assuming Hardy Weinberg equilibrium, about how many U.S. residents are expected to be carriers of deleterious LRP5 mutations?

2 Molecular Genetics FNAL page 2 of 7 5. (6 points) cinnabar (cn) and brown (bw) are two loci in Drosophila with recessive eye color mutations. Mutations in cn cause a bright red eye. Mutations in bw cause a brown eye. Double mutants have white eyes. f you cross cinnabar (cn) and brown (bw) together, cross the F1 inter se and then look at the F2, what ratio do you expect of wild-type red: bright red: brown: whiteeyed flies. Use a Punnett square to illustrate. 6. (12 points) Other common ratios in a dihybrid cross are 9:4:3, 9:7 and 15:1. Please explain each of these three ratios in relation to the type of dominance shown by mutations in each gene and the relationship between those mutations. Your answer should mention epistasis and synthetic phenotypes.

3 Molecular Genetics FNAL page 3 of 7 This pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for three markers, A, B and C, are shown The genotypes are: -1 A1,4 B1,4 C3,4-1 A1,2 B1,3C1,2-2 A3,4 B3,4 C1,4-2 A3,3 B3,3 C1,3-3 A1,4 B1,4 C3,4-1 A1,3 B1,3 C1,3-4 A1,4 B1,4 C3,4-2 A4,4 B4,4C4,4-5 A3,4 B3,4 C3,4 7. (4 pt.) Considering only the data for marker locus A (i.e. ignoring B and C), what is the approximate lod score for linkage between A and the disease gene with θ = 0? 8. (4 pt.) Considering only the data for marker locus B, what is the approximate lod score for linkage between B and the disease gene with θ = 0? 9. (4 pt.) Considering only the data for marker locus C, for what value of θ would you expect the maximal lod score for linkage between C and the disease gene?

4 Molecular Genetics FNAL page 4 of (4 points). You learn that A, B and C are in that order (ABC) along the chromosome and are very closely linked. (Apply that information to this question only). Using this information, which of the following is the mostly likely set of haplotypes of individual -1? a) A1 B1 C1 / A3 B3 C3 b) A1 B1 C3 / A3 B3 C1 c) A1 B3 C1 / A3 B1 C3 d) A3 B1 C1 / A1 B3 C3 11. (10 points). Recall that the phenotype of etr1-1 is insensitivity to ethylene, that the phenotype of ctr1-1 is a constititive ethylene response and that the double mutant etr1-1 ctr1-1 shows the constititive ethylene response. Another mutation, ein3, is also insensitive to ethylene but shows a different interaction with ctr1-1: the double mutant ein3 ctr1-1 is insensitive to ethylene. Applying all of the information that was given in class, what does this imply about the position of ein3 in the signaling pathway? (5 points each). n each of the following there are two or more statements. One is true (generally, it is taken directly from your textbook) and the others have been modified so that to be untrue or misleading. Circle, check or otherwise designate the correct statement. Ambiguous marks (checking both, placing a mark between the two statements, etc.) will be considered wrong. 12. a) General transcription factors bind indirectly to the promoter (by enhancing the affinity of RNA polymerase for the promoter). b) General transcription factors bind directly to the double-stranded DNA promoter. 13. a) Recombinant inbred strains are obtained by systematically inbreeding the progeny of a cross. b) Recombinant inbred strains are obtained by transformation of an inbred strain with recombinant DNA.

5 Molecular Genetics FNAL page 5 of a) Approximately 5% of the human genome appears to be functional (based on conservation among mammals) and about 1/5 of that is protein-coding. b) Approximately 50% of the human genome appears to be functional (based on conservation among mammals) and about 1/5 of that is protein-coding. c) Approximately 5% of the human genome appears to be functional (based on conservation among mammals) and most of that (at least 80%) is protein-coding. d) Approximately 50% of the human genome appears to be functional (based on conservation among mammals) and about 1/50 of that is protein-coding. 15. a) Certain patterns of histone acetylation are associated with transcriptionally inactive chromatin, and transcriptional repressors, by recruiting histone acetylases, produce these patterns. b) Certain patterns of histone acetylation are associated with transcriptionally active chromatin, and gene activator proteins, by recruiting histone acetylases, produce these patterns. 16. a) ApT dinucleotides mutate at a high rate because adenosine is vulnerable to deamination; adenosines in ApT dinucleotides are often methylated, and deamination of adenosine produces inosine, which pairs like guanosine. b) CpG dinucleotides mutate at a high rate because cytosine is vulnerable to deamination; cytosines in CpG dinucleotides are often methylated, and deamination of 5-methylcytosine (5mC) produces thymidine. 17. a) n the plasmid shuffle procedure, if the experimental yfg1-x allele is completely nonfunctional, the strain will not grow on FOA medium. b) n the plasmid shuffle procedure, if the experimental yfg1-x allele is completely nonfunctional, the strain will grow on FOA medium a) Researchers have developed an efficient means to promote meiotic recombination by using FLP, a site-specific recombinase from yeast. b) Researchers have developed an efficient means to promote mitotic recombination by using FLP, a site-specific recombinase from yeast. 19. a) RNA editing involves the deamination of adenosines at specific sites, but this process is limited to noncoding RNAs and does not affect the amino acid sequence of proteins. b) RNA editing involves the deamination of adenosines at specific sites, the result of which can be a change in the amino acid sequence of the protein so that it differs from that predicted by the sequence of the DNA. 20. a) A haplotype is the set of alleles found together on a single chromosome. b) The haplotype is a vegetative state of yeast (e.g. Saccharomyces cereivisiae) carrying a haploid set of chromosomes. 21. a) Linkage is a relation between alleles, but association is a relation between loci. b) Association is a relation between alleles, but linkage is a relation between loci. c) Linkage and association are relations between alleles. d) Linkage and association are relations between loci.

6 Molecular Genetics FNAL page 6 of a) Balancer chromosomes carry both a dominant marker and inversions that prevent the balancer chromosome from recombining witha an experimental chromosome. b) Balancer chromosomes carry two arms (designated left and right or p and q) of nearly equal length. 23. a) A gynandromorph is a type of dominant allele that expresses its phenotype only in males. b) A gynandromorph is a mosaic animal carrying both male and female cells, derived from an embryo that has lost an X chromosome during the first mitotic division. 24. a) X inactivation is the means by which mammals accomplish paternal imprinting. b) X inactivation is the means by which mammals accomplish dosage compensation. 25. a) The leucine zipper is a common dimerization motif in transcription factors. b) The leucine zipper is a common activation domain in transcription factors. 26. a) Epigenetic changes alter gene activity without modifying the DNA sequence. b) Epistatic changes alter gene activity without modifying the DNA sequence. 27. a) During the initiation of translation, the 3' end of the rrna in the 30S ribosomal subunit basepairs with the Shine-Dalgarno sequence in the mrna. b) During the initiation of translation, the anticodon loop of the initiator trna basepairs with the Shine-Dalgarno sequence in the mrna. 28. a) Haploinsufficiency is a rare form of sterility in which germ cells die following meiosis. b) Haploinsufficiency is a rare form of dominance in which an individual heterozygous for a wild-type allele and a null allele shows an abnormal phenotype. 29. a) A rare class of dominant alleles arises from neomorphic mutations that generate a novel phenotype unrelated to the normal function of the mutant gene. b) A rare class of dominant alleles arises from neomorphic mutations that generate a novel phenotype unaffected by the dosage or level of expression of the wild-type locus. 30. a) mirnas are encoded by RNA genes and are processed from primary transcripts. b) sirnas are encoded by RNA genes and are processed from primary transcripts. 31. a) sirnas are involved in pre-mrna splicing and are part of the spliceosome. b) sirnas are involved in the RNA interference pathway whereby the sirna interferes with the expression of one or more target genes. 32. a) linkage disequilibrium is a general term for the non-random transmission of linked alleles in a pedigree. b) linkage disequilibrium refers to the non-random association of alleles at two or more loci, not necessarily on the same chromosome. 33. a) The primer DNA provides a terminus with a free 3'-OH to which nucleotides are added during DNA synthesis. b) The template DNA provides a terminus with a free 3'-OH to which nucleotides are added during DNA synthesis.

7 Molecular Genetics FNAL page 7 of 7 Define the following terms (5 points each). NMD EJC RSC complex hypomorphic allele Xist RNA