8.1 Demonstrate the ability to analyze different patterns of inheritance that lead to the variation of offspring in sexual reproduction.

Transcription

1 Name: Unit 8 Mendelian Genetics Theme: DNA Heredity Students will be able to: 8.1 Demonstrate the ability to analyze different patterns of inheritance that lead to the variation of offspring in sexual reproduction. Explain the concept of dominant and recessive gene traits Distinguish between genotypes and phenotypes Explain patterns of inheritance (monohybrid, dihybrid, complete dominance, incomplete dominance, codominance, and sex-linked). Use a Punnett Square to predict the possible genotypes and phenotypes that can result from the above patterns of inheritance. 8.2 Discuss how mutations within the DNA and chromosomal abnormalities may lead to a variety of genetic diseases. Use a Karyotype to identify problems in the number of chromosomes Discuss several different genetic disorders, including how they are inherited how they affect the body. Use Gel Electrophoresis and knowledge of inheritance to determine which individuals are carriers or affected by a genetic disorder. Keywords: Heredity Segregation Punnett Square Genetics Fertilization Independent Assortment Complete Dominance Trait Hybrids Genes Homozygous Heterozygous Genotype Incomplete Dominance Codominance Alleles Dominant Recessive Phenotype Test Cross Probability Sex Linked Carrier Pedigree

2 Mendelian Genetics Unit Date Topic 2/26 Genetics and Heredity Annotated Reading 2/27 Mendelian Genetics Vocabulary Word Wall 2/28 Probability and Punnett Square Notes and Punnett Square Card Practice 3/1 Human Traits Activity 3/4 Dihybrid Crosses Notes and Practice 3/5 Incomplete Dominance Notes and Practice 3/6 Other Patterns of Inheritance: Codominance Notes and Baby Mix-Up Practice 3/7 Other Patterns of Inheritance: Sex-Linked Traits Notes and Practice 3/8 Dragon Babies 3/11 Pedigree Notes and Practice 3/12 Pedigree Practice 3/13 FRQ Practice 3/14 Genetic Diseases Research Project 3/15 Genetic Diseases Research Project 3/18 Genetic Diseases Presentations 3/19 Genetic Diseases Presentations 3/20 Mendelian Genetics Unit Review 3/21 Molecular and Mendelian Genetics Unit FRQ 3/22 Mendelian Genetics Unit MC Test 2/26/19 Objective: Students will be able to explain the concept of dominant and recessive gene traits and distinguish between genotypes and phenotypes to analyze different patterns of inheritance that lead to the variation of offspring in sexual reproduction. Warm Up: 1. What are two things that I want you to know by the end of this unit? 2. When is your unit test? 8.1 Genetics and Heredity As you read: Underline key ideas Define and draw a picture of the vocabulary words Put a question mark next to ideas you don t understand or want to know more about. Answer the questions in the boxes. Think About It What is inheritance? To many people, it is money or property left to them by relatives who have passed away. That kind of inheritance matters, of course, but there is another kind that matters even more. It is something we each receive from our parents-a contribution that determines our blood type, the color of our hair, and so much more. Most people leave their money and property behind by writing a will. But what kind of inheritance makes a person s face round or their hair curly? 2

3 The Experiments of Gregor Mendel Where does an organism get its unique characteristics? Every living thing-plant or animal, microbe or human being-has a set of characteristics inherited from its parent or parents. Since the beginning of recorded history, people have wanted to understand how that inheritance is passed from generation to generation. The delivery of characteristics from parent to offspring is called heredity. The scientific study of heredity, known as genetics, is the key to understanding what makes each organism unique. The modern science of genetics was founded by an Austrian monk named Gregor Mendel. Mendel was born in 1822 in what is now the Czech Republic. After becoming a priest, Mendel spent several years studying science and mathematics at the University of Vienna. He spent the next 14 years working in a monastery and teaching high school. In addition to his teaching duties, Mendel was sin charge of the monastery garden. In this simple garden, he was to do the work that changed biology forever. Vocabulary: Heredity Definition: Picture: Genetics Definition: Picture: Mendel carried out his work with ordinary garden peas, partly because peas are small and easy to grow. A single pea plant can produce hundreds of offspring. Today we call peas a model system. Scientists use model systems because they are convenient to study and may tell us how other organisms, including humans, actually function. By using peas, Mendel was able to carry out, in just one or two growing seasons, experiments that would have been impossible to do with humans and that would have taken decades-if not centuries- to do with pigs, horses, or other large animals. The Role of Fertilization When Mendel began his experiments, he knew that the male part of each flower makes pollen, which contains the plant s male reproductive Vocabulary: cells, called sperm. Similarly, Mendel knew that the female portion of Fertilization each flower produces reproductive cells called eggs. During sexual Definition: reproduction, male and female reproductive cells join in a process known as fertilization to produce a new cells. In peas, this new cell develops into a tiny embryo encased within a seed. Picture: Trait Definition: Picture: Pea flowers are normally self-pollinating, which means that sperm cells fertilize egg cells from within the same flower. A plant grown from a seed produced by self-pollination inherits all of its characteristics from the single plant that bore it; it has a single parent. Mendel s monastery garden had several stocks of pea plants. These plants were true-breeding, meaning that they were selfpollinating, and would produce offspring identical to themselves. In other words, the traits of each successive generation would be the same. A trait is a specific characteristic, such as seed color or plant height, of an individual. Many traits vary from one individual to 3

4 another. For instance, one stock of Mendel s seeds produced only tall plants, while another produced only short ones. One line produced only green seeds, another produced only yellow seeds. To learn how these traits were determined, Mendel decided to cross his stocks of truebreeding plants-that is, he caused one plant to reproduce with another plant. To do this, he had to prevent self-pollination. He did so by cutting away the pollen-bearing male parts of a flower. He then dusted the pollen from a different plant onto the female part of that flower, as shown in the figure to the right. This process, known as cross-pollination, produces a plant that has two different parents. Cross-pollination allowed Mendel to breed plants with traits different from those of their parents and then study the results. Mendel studied seven different traits of pea plants. Each of these seven traits had two contrasting characteristics, such as green seed color or yellow seed color. Mendel crossed plants with each of the seven contrasting characteristics and then studied their offspring. The offspring of crosses between parents with different traits are called hybrids. Why do you think true-breeding pea plants were important for Mendel s experiments? Vocabulary: Hybrids Definition: Picture: Using your definition for hybrid, explain why some cars are called hybrids. Genes Definition: Picture: Genes and Alleles When doing genetic crosses, we call each original pair of plants the P, or parental, generation. Their offspring are called the F 1, or first filial, generation. (Filius and filia are the Latin words for son and daughter ). What ere Mendel s F 1 hybrid plants like? To his surprise, for each trait studied, all of the offspring had the characteristics of only one of its parents, as shown in the figure below. In each cross, the nature of the other parent, with regard to each trait, seemed to have disappeared. From these results, Mendel drew two conclusions. His first conclusion formed the basis of our current understanding of inheritance. An individual s characteristics are determined by factors that are passed from one parental generation to the next. Today, scientists call these factors that are passed down from parent to offspring genes. 4

5 Each of the traits Mendel studied was controlled by a single gene that occurred in two contrasting varieties. These variations produced different expressions, of forms, of each trait. For example, the gene for plant height occurred in one form that produced tall plants and in another form that produced short plants. The different forms of a gene are celled alleles (uh leelz). Vocabulary: Alleles Definition: Parakeets come in four different colors: white, green, blue, and yellow. How many alleles do you think there are for feather color? Explain. Picture: Principle of Dominance Definition: Picture: Dominant and Recessive Alleles Mendel s second conclusion is called the principle of dominance. This principle states that some alleles are dominant and others are recessive. An organism with at least one dominant allele for a particular form of a trait will exhibit that form of the trait. An organism with a recessive allele for a particular for of a trait will exhibit that form only when the dominant allele for the trait is not present. In Mendel s experiments, the allele for tall plants was dominant and the allele for short plants was recessive. Likewise, the allele for yellow seeds was dominant over the recessive allele for green seeds. Using the chart above, determine the dominant allele for each of the following genes. Seed Shape: Pod Color: Seed Coat: Flower Position: Pod Shape: 5

6 Humans inherit alleles from their parents. Children who exhibit a dominant trait such as freckles must receive the dominant allele from one of their parents. The following table shows some dominant traits exhibited by Sara and her parents. Sara s Dad Sara s Mom Sara Freckles Yes Yes Yes Cheek Dimples Yes No Yes Free Ear Lobes Yes No No Which traits in the table above are dominant traits? How do you know? In the future, Sara will marry a man with freckles. However, her son will not have freckles. How is that possible? Segregation How are different forms of a gene distributed to offspring? Mendel didn t just stop after crossing the parent plants, because he had another question: Had the recessive alleles simply disappeared, or were they still present in the new plants? To find out, he allowed all seven kinds of F 1 hybrids to self-pollinate. The offspring of an F 1 cross are called the F 2 (second filial) generation. In effect, Mendel crossed the F 1 generation with itself to produce the F 2 offspring, as shown in the figure to the right. The F 1 Cross When Mendel compared the F 2 plants, he made a remarkable discovery: The traits controlled by the recessive alleles reappeared in the second generation. Roughly one fourth of the F 2 plants showed the trait controlled by the recessive allele. Why, then, did the recessive alleles seem to disappear in the F 1 generation, only to reappear in the F 2 generation? 6

7 Explaining the F1 Cross To begin with, Mendel assumed that a dominant allele had masked the corresponding recessive allele in the F 1 generation. However, the trait controlled by the recessive allele did show up in some of the F 2 plants. This reappearance indicated that, at some point, the allele for shortness had separated from the allele for tallness. How did this separation, or segregation, of alleles occur? Mendel suggested that the alleles for tallness and shortness in the F 1 plants must have segregated from each other during the formation of the sex cells, or gametes (GAM eetz). Did that suggestion make sense? Vocabulary: Segregation Definition: Picture: The Formation of Gametes Let s assume, as Mendel might have, that all the F 1 plants inherited an allele for tallness from the tall parent and one for shortness from the short parent. Because the allele for tallness is dominant, all the F 1 plants are tall. During gamete formation, the alleles for each gene segregate from each other, so that each gamete carries only one allele for each gene. Thus, each F 1 plant produces two kinds of gametes-those with the tall allele and those with the short allele. Look at the figure to the left to see how alleles separate during gamete formation and then pair up again in the F 2 generation. A capital letter represents a dominant allele. A lower case letter represents a recessive allele. Now we can see why the recessive trait for height, t, reappeared in Mendel s F 2 generation. Each F 1 plant in Mendel s cross produced two kinds of gametes-those with the allele for tallness and those with the allele for shortness. Whenever a gamete carried the t allele paired with the other gamete that carried the t allele to produce and F 2 plant, that plant was short. Every time one or both gametes of the pairing carried the T allele, a tall plant was produced. In other words, the F 2 generation had new combinations of alleles. The capital letter G represents the allele in peas that causes the dominant trait, gray seed coat. The lower-case letter g represents the recessive allele that causes the recessive trait, white seed coat. In the circles, show the alleles in the gametes of the parent generation. Then, show how the alleles recombine in the F 1 plants. 7

8 2/27/19 Objective: Students will be able to explain a monohybrid and dihybrid pattern of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm-Up: 1. A black cat and a white cat have four black kittens in the F 1 generation. In the F 2 generation, there are three black kittens and one white kitten. Explain how the F 2 generation proves that genetic information passes unchanged from one generation to the next, even when a specific trait is not exhibited. 2/28/19 Objective: Students will be able to explain a monohybrid and dihybrid pattern of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: 1. Using your knowledge of the laws and principles of heredity (principle of dominance, law of segregation, and law of independent assortment), explain why two siblings can be vastly different even though they get the same genetic material from the same parents. 8.2 Probability and Punnett Squares Probability: Example: Coin flip o Probability of flipping a heads: ½ or 50% o Probability of flipping 3 heads in a row: ½ x ½ x ½ = 1/8 or 12.5% Using Segregation to Predict Outcomes We can use to predict the outcome of genetic matches because of the way that alleles will during gamete formation is just as as flipping a coin. 8

9 Mendel s Example: o If each F 1 plant has a tall allele T and a short allele t than ½ the offspring would carry the short allele t. BUT the t allele is recessive so the only way to show the trait is to have two short alleles combine tt o In the F 2 generation, each gamete also has a one in two (½) chance of having the short allele T. Two gametes are needed to create a new plant so the probability of both gametes carrying the short allele t is ½ X ½ OR ¼. This means that plants will be and will be. o These ratios showed up consistently in Mendel s experiments-proving that segregation occurs. Combinations of Alleles Not all organisms with the same trait have the same combination of alleles. For example, in Mendel s pea experiment-the Tt alleles and the TT alleles both produced tall pea plants. o When organisms have for a particular gene, we call them. TT or tt o When organisms have for a particular gene, we call them. Tt Genotype vs. Phenotype Every organisms has a genetic makeup as well as a set of observable characteristics. o A is the and is inherited Example: TT, Tt, tt o A is the which are determined by the genotype and the environment. Example: Tt and TT = Tall phenotype o Two organisms may share the same phenotype but have different genotypes. 9

10 Punnett Squares : a cross between two organisms to determine the genotype and phenotype of the offspring. Punnett Square: Diagrams that predict the outcome of a genetic cross by considering all possible combinations of gametes in the cross. Using Punnett Squares: 10

11 Monohybrid Example: The mother is homozygous recessive and the father is homozygous dominant. Draw a Punnett square to determine the possible: a. Genotypes: b. Phenotypes: 3/1/19 Objective: Students will be able to explain a monohybrid and dihybrid pattern of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: Use a Punnett Square to predict the possible offspring in the following matches. 1. One cat carries heterozygous, long haired traits and its mate carries homozygous recessive short-haired traits. a. Genotypes of the parents: b. Genotypes of the offspring: c. Phenotypes of the offspring: 2. Order the steps below to represent the sequence of events in protein synthesis. A. The amino acids interact to fold into a completed protein. B. trna adds amino acids using the mrna strand as a template. C. RNA polymerase pairs RNA nucleotides with the DNA bases forming mrna. D. mrna leaves the nucleus of the cell. E. RNA polymerase breaks the hydrogen bonds between strands in the DNA double helix. F. mrna joins the small and large subunits of the ribosome in the cytoplasm. 11

12 3/4/19 Objective: Students will be able to explain a monohybrid and dihybrid pattern of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: 1. Vocabulary Scramble: Use the definition to unscramble the following vocabulary words. Vocabulary Word Scrambled Word Definition eecgtnis The scientific study of heredity onindmat ydrhibs llleeas osumhoygzo edyrheit tyheonepp epngotye ecevesrsi riatt etehzrooguys negse Expressed trait Offspring of crosses between parents with different traits Different forms or versions of a gene Two identical alleles Delivery of characteristics from parent to offspring The physical trait that is determined by the genotype and the environment The inherited genetic makeup Only expressed if no dominant trait is present Specific characteristics of an individual Two different alleles Characteristics determined by factors that are passed from generation to generation 8.3 Dihybrid Crosses and Independent Assortment Independent Assortment After his first round of experiments, Mendel wondered if the segregation of one pair of alleles affects another pair. o For example: does the alleles for seed color affect the alleles for seed shape? To find out-mendel followed two different traits as they passed from one generation to the next. o In the F 1 generation, he crossed plants that produced round yellow peas ( ) with plants that produced wrinkled green peas ( ). This generation produced the hybrids ( ) that he needed for the next generation. 12

13 o Then he crossed the F 1 generation to produce an F 2 generation. The results were: 556 seeds total 315 round and yellow seeds 32 wrinkled and green seeds seeds with a combination of phenotypes not present in the original parent plants. o This type of cross is called a Independent Assortment: o Example: Your hair color does not determine your height. Dihybrid Crosses: in a dihybrid cross, you are determining the genotype and phenotype for two parents that each have 2 traits. Steps to Making a Dihybrid Cross **See page 10** Example: A heterozygous female mouse for black, short hair is crossed with a homozygous recessive male with white fur and long hair. 1. What are the genotypes of mom and dad? Mom: Dad: 2. What are the possible gametes after the FOIL? 3. What are the genotypic ratios for the offspring? 4. What are the phenotypic ratios for the offspring? A Summary of Mendel s Principles The inheritance of biological characteristics is determined by individual units called, which are passed from. Where two or more forms (alleles) of the gene for a single trait exist, some may be and others may be. In most sexually reproducing organisms, each adult has two copies of each gene-one from each parent. These genes from each other when are formed. Alleles for usually from each other when gametes are formed. 13

14 3/5/19 Objective: Students will be able to explain complete and incomplete dominance patterns of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: (2 Questions) 1. In certain species of plants, the color purple (P) is dominant to the color white (p). According to the Punnett square, what is the probability of an offspring being white? 2. In certain species of pine trees, short needles (S) are dominant to long needles (s). According to the Punnett square, what is the probability of an offspring having long needles? 8.4 Incomplete Dominance Complete Dominance: Incomplete Dominance: When an offspring s phenotype is a blend of the two parents Examples: o If you take a red flower and a white flower and you breed them, you get a blending of the two colors and get a pink flower o o Using a Punnett square for incomplete dominance: Use only capital letters- since there is no dominant trait Place the two traits onto the Punnett square, the same has you have before. Cross the traits in the square 14

15 Example: A cross between a white mouse and a black mouse with create grey offspring. a. Parent genotype: b. Offspring genotype: c. Offspring phenotype: 3/6/19 Objective: Students will be able to explain codominant and sex linked patterns of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: 1. Coat color in mice is incompletely dominant. Yellow and white colored mice are homozygous while cream colored mice are heterozygous. If two cream colored mice mate, what are the possible genotypes and phenotypes of the offspring? a. Genotypes of the parents: b. Genotypes of the offspring: c. Phenotypes of the offspring: 8.5 Other Patterns of Inheritance: Codominance Codominance: Phenotype produced when both alleles are clearly expressed Examples: o o AB Blood Types (the A and B proteins appear on the surface of your blood cells together) Blood Type is codominant! There are four major blood groups determined by the presence or absence of two antigens (proteins)-a and B-on the surface of red blood cells. o Group A-has only the A antigen on the red blood cells (B antibody in the plasma) o Group B-has only the B antigen on the red blood cells (A antibody in the plasma) o Group AB-has both A and B antigens on the red blood cells (neither A or B antibody in the plasma) 15

16 o o Group O-has neither A nor B antigens on the red blood cells (both A and B antibody in the plasma) There are 3 alleles of the gene that controls blood type: I A, I B, i The I stands for immunoglobin, or the type of white blood cell that would be triggered to attack I A and I B are codominant genes, meaning when inherited together, they are both fully expressed, not blended like in incomplete dominance. i is the recessive form of the allele. Fill in the phenotype for the following genotypes. Genotype I A I A or I A i I B I B or I B i I A I B ii Phenotype Using a Punnett square to represent traits: o Use only capital letters- since there is no dominant trait o Place the two traits onto the Punnett square, the same has you have before. o Cross the traits in the square Example: Jessica has B blood type. Jessica s mom has blood type O. Jessica has a baby with John, who has type AB blood. a. Parent genotype: b. Offspring genotype: c. Offspring phenotype: 3/7/19 Objective: Students will be able to explain codominant and sex-linked patterns of inheritance and use a Punnett square to predict the possible genotypes and phenotypes that can result when two genotypes are crossed. Warm Up: 1. Given the following DNA strand, write the complementary strand of DNA. ATTCGCTAGCACGTACGTCTAGCGCTACGCATG 2. What is the amino acid sequence for the above DNA strand? (Hint: you need an mrna strand and your codon chart) 16

17 8.6 Other Patterns of Inheritance: Sex-Linked Traits Chromosomes Humans have 22 pairs of autosomes and 1 pair of sex chromosomes. o Males are Males donate their Y chromosome to their sons only and their X chromosome to their daughters only. They determine the sex of the child! o Females are Females donate one or the other of their X chromosomes to their sons and daughters. Sex-Linked: Occur most often in males because they only receive one X chromosome from their mother. Most of these genes are recessive, which means mom can be a carrier and pass the trait to her offspring o A carrier is a female who is heterozygous for a trait and can pass the trait on to her offspring but does not show symptoms of the trait. Examples: o o Using a Punnett square to express traits o Determine the genotypes of the parents Mom is a carrier: Xx heterozygous Mom is not a carrier: XX homozygous Mom shows trait: xx homozygous recessive Dad normal : XY o Place the genotypes on the Punnett square has you have before o Use the squares to cross traits o Determine the genotype and phenotypes of the offspring Male = XY, xy Female= XX, Xx Example: Carol is a carrier for the recessive sex-linked trait that causes red-green color blindness. Carol has a baby will Bill, who is normal. a. Parent genotype: b. Offspring genotype: c. Offspring phenotype: d. Proportion of male offspring: e. Proportion of male offspring with red-green color blindness: 17

18 3/8/19 Objective: Students will be able to simulate patterns of inheritance by creating a dragon offspring. Warm Up: 1. How many chromosomes do humans have? How many chromosomes are in our gametes? 2. What chromosomes do you contain if you are a female? Male? 3/11/19 Objective: Students will be able to trace patterns of inheritance through multiple generations using pedigree charts. Warm-Up: 1. Identify each type of mutation a. CCGTACTGA becomes CCGACTGA b. CCGTACTGA becomes CCGTACAGA c. CCGTACTGA becomes CCGTACTTCGA 2. What is the effect of each type of mutation above on the amino acid sequence? What is a Pedigree? 8.7 Pedigrees Pedigrees study how a is passed from one generation to the next. o By recording phenotypes of family members o Be observing the phenotypes of family members, we can infer the genotypes. Remember, conditions and disorders can be carried on: o (22 pairs of chromosomes) o (X or Y) Keep in mind: traits are influenced heavily by or o Examples: life style, geography, nutrition and exercise, toxins (mutagens), and disease and age. Parts of a Pedigree Shapes o are males (XY) o are females (XX) o Diamond is undermined sex 18

19 Lines o lines connect breeding couples o lines connect parents to children o A line means Filling o means the individual has the trait o or a means they carry the gene called a carrier o means the individual does not have the trait Identifying Individuals o show generations (oldest generation is on the top and youngest is on the bottom) o assign an individual to a generation and birth order (oldest from left to right) More pedigree symbols and meanings: Interpreting Pedigrees 1. Determine if the trait is dominant or recessive. a. Every other generation: it is b. Every generation: it is 2. Determine if the trait is autosomal or sex linked. a. Affects males and females equally: b. Affects one sex more that the other, especially males: i. Typically sex-linked disorders or traits are carried on the X chromosome 1. tend to a trait and affect their. 2. Females get the trait from an affected father or carrier/affected mother. 3. Affected got it from their and give it to their to carry 3. Assign genotypes to (shaded) individuals first. a. If then use two alleles to show inheritance i. Example: AA, Aa, aa b. If then use one allele for males, two for females i. The males will carry the gene (X c Y) and be affected. 19

20 ii. The females can be (X c X c ) if they inherited two copies of the gene 4. Assign remaining genotypes to (unshaded) individuals a. If sex-linked: the males will not carry the gene (X C Y) and not be affected, marked with a dot or half shaded (X C X c ), along with unaffected females (X C X C ) 5. your work, does the pedigree make sense? Let s Practice! Your Turn! Is this dominant or recessive? Is this autosomal or sex-linked? Assign genotypes to the pedigree to show the inheritance pattern. Is this dominant or recessive? Is this autosomal or sex-linked? Assign genotypes to the pedigree to show the inheritance pattern 20

21 3/12/19 Objective: Students will be able to trace patterns of inheritance through multiple generations using pedigree charts. Warm-Up: 1. Match the labels to the parts of the pedigree chart shown below. Some of the labels may be used more than once. A person who expresses the trait. A male A person who does not express the trait A marriage A female A connection between parents and offspring. Vocabulary Builder: Match the vocabulary word to the definition and then tell how you are going to remember the word. (8 words) Match Word Definition How am I going to remember it? Segregation A. Diagram that can be used to predict the offspring of a genetic cross Probability Punnett Square B. Genes for different traits segregate independently when gametes are formed. C. A female who is heterozygous for a trait and can pass it to her offspring 21

22 Incomplete Dominance D. Separation of alleles during formation of sex cells Codominance E. The likelihood that a particular event will occur Independent Assortment Carrier F. Diagram that shows how traits are inherited in many generations. G. Both alleles show up as a mixture in the phenotype Pedigree H. Both alleles show up together but distinct in the phenotype 3/13/19 Objective: Students will be able to trace patterns of inheritance through multiple generations using pedigree charts. Warm-Up: (3 Questions) Dimples in the cheeks are inherited at a dominant trait on an autosome. The father is heterozygous for dimples and the mother is homozygous recessive. 1. Determine the genotypes for the parents based on the phenotype. 2. Use a Punnett square to determine the genotype and phenotype of the possible offspring. 3. Draw a pedigree showing the parents and all four potential offspring to trace the inheritance of the dimpled cheek trait. Include the genotype and phenotype for all members on your pedigree. 22

23 3/14/19 Objective: Students will be able to discuss how mutations within the DNA and chromosomal abnormalities may lead to a variety of genetic diseases including how they are inherited and how they affect the body. Warm Up: Use a Punnett Square to predict the possible offspring in the following matches. 1. Yellow fruit and dwarf vines are recessive traits in tomatoes. Red fruit and tall vines are dominant. You cross a completely dominant red and tall plant with a heterozygous red and dwarf plant. a. Parent 1 genotype: b. Parent 2 genotype: c. What percent of the offspring will be totally heterozygous? d. What percent of the offspring will have yellow fruit and dwarf vines? 23

24 3/15/19 Objective: Students will be able to discuss how mutations within the DNA and chromosomal abnormalities may lead to a variety of genetic diseases including how they are inherited and how they affect the body. Warm Up: Use a Punnett Square to predict the possible offspring in the following matches. 1. In Andalusian fowls (birds), black individuals (B) and white individuals (W) are homozygous. A homozygous black bird is crossed with a homozygous white bird. The offspring are all a bluishgray. A black individual is crossed with a bluish-gray individual. a. Parent 1 genotype: b. Parent 2 genotype: c. Offspring genotypes: d. Offspring phenotypes: 3/18/19 Objective: Students will be able to discuss how mutations within the DNA and chromosomal abnormalities may lead to a variety of genetic diseases including how they are inherited and how they affect the body. Warm Up: Use a Punnett Square to predict the possible offspring in the following matches. 1. In some chickens, the gene for feather color is controlled by codominance. The allele for black is B and the allele for white is W. The heterozygous phenotype is known as erminette (black and white spotted). Two erminette chickens were crossed. a. Parent 1 genotype: b. Parent 2 genotype: c. What is the probability that they would have a black chick? d. What is the probability that they would have an erminette chick? 24

25 3/19/19 Objective: Students will be able to discuss how mutations within the DNA and chromosomal abnormalities may lead to a variety of genetic diseases including how they are inherited and how they affect the body. Warm Up: 1. Go back to the front page of this packet and read through the essential outcomes. Put a question mark next to the topics that you still have questions about. Put a check mark next to the topics that you feel confident about. 2. How are you going to go about learning those topics that have a question mark next to them? 3/20/19 Objective: Students will be able to demonstrate their knowledge of Mendelian genetics on a unit review. Warm Up: Match the genetic disease on the top with the effects on the body on the bottom. 1. Sickle-cell Disease 2. Tay-Sachs Disease 3. Huntington s Disease 4. Cystic Fibrosis 5. Phenylketonuria (PKU) A. Individuals with this disorder are unable to metabolize certain lipids, affecting proper brain development. Affected individuals die in early childhood. B. This is caused by a dominant single gene defect and generally does not appear until the individual is years of age. C. Effects of this recessive disorder can be completely overcome by regulating the diet of the affected individual. D. Effects of this recessive disorder result in a defect in membrane proteins that normally function in chloride transport. E. Heterozygotes with this disease can be resistant to malaria. 3/21/19 Objective: Students will be able to demonstrate their knowledge of Mendelian genetics on a unit test. Warm Up: None 3/22/19 Objective: Students will be able to demonstrate their knowledge of Mendelian genetics on a unit test. Warm Up: 1. Turn your work into the basket. 25