Angeles Duran, Juan F. Linares, Anita S. Galvez, Kathryn Wikenheiser, Juana M. Flores, Maria T. Diaz-Meco, and Jorge Moscat

Transcription

1 Cancer Cell, Volume 13 Supplemental Data The Signaling Adaptor p62 Is an Important NF-κB Mediator in Tumorigenesis Angeles Duran, Juan F. Linares, Anita S. Galvez, Kathryn Wikenheiser, Juana M. Flores, Maria T. Diaz-Meco, and Jorge Moscat Supplemental Experimental Procedures Reagents and antibodies Reagents were purchased as follows: DRB, wortmannin, NAC, doxycycline, BHA, polybrene and H 2 O 2 were from Sigma, and PD98159 from Calbiochem. Polyclonal anti-phospho-akt, anti- AKT, anti-phospho-s6k, anti-phospho-atf2, anti-atf2, anti-phospho-p38, anti-p38, antiphospho-ikkα/β and anti-jnk antibodies were from Cell Signalling. Anti-actin, anti-phospho- JNK, anti-ikkβ, anti-ikkγ, anti-traf6, anti-ubi, anti-phospho-c-jun, and anti-c-jun antibodies were purchased from Santa Cruz. Polyclonal anti-p62 C-ter was from Progen and human monoclonal anti-p62 was from BD. Anti-Ras was from Calbiochem. All antibodies were used according to manufacturers instructions. Cell culture WT and p62 KO primary EFs were derived from E13.5 embryos (Garcia-Cao et al., 2003). Cells were maintained in DMEM (Gibco BRL) supplemented with 10% (v/v) fetal calf serum (FCS), 1% glutamine and 1% penicillin/streptomycin (Gibco-Invitrogen) in an atmosphere of 95% air and 5% CO2, and immortalized by retroviral infection with pbabet-ag followed by puromycin selection (1µg/ml). The established cell lines represent pools of at least 100 independent clones. The HEK293-derived virus packaging cell line 293T, HeLa cells and all human cancer lines were cultured in DMEM with 10% FCS. For knockdown of p62 in human cancer cell lines, two different human sirnas for p62 were obtained from Qiagen with the following target sequences: TAGGGTGCAAGAAGCCATTTA and CTCATAGGTCCCTGACATTTA. AllStars Negative Control sirna (Qiagen) was used as negative control. Transfection of srnai was performed by calcium phosphate method. Reporter κb assays were performed as described (Sanz et al., 2000) using Renilla to normalize transfection efficiency. Transfection of EFs for κb assays and for RelA immunofluorescence was performed by Fugene, following manufacturers instructions. For immunofluorescence, The different p62 promoter deletions were subcloned into pgl3-basic vector (Promega). A point mutation to disrupt the AP1 enhancer element in the p62 promoter was introduced by Site Directed Mutagenesis (Stratagene): AP1 site (TGACTCA) was mutated to AP1 mut (TCTGTCA). Retroviral transduction Retroviral expression vectors pwzl-hygro, pwzl-hygro-h-rasv12 and pbabe-large-t-ag have been previously described (Barradas et al., 1999). For p62 reconstitution experiment, pbabe-ha-p62 was used. Retroviruses were produced in 293T cells by transient transfection by Lipofectamine 2000 (Invitrogen). Culture supernatants were collected 24 h, 48 h and 72 h posttransfection, filtered (0.45 µm) and supplemented with 4µg/ml polybrene. EFs were infected with three rounds of viral supernatants and selected with hygromycin (75 µg/ml) in the indicated experiments. 1

2 Confocal analysis EFs WT or p62 KO transfected with HA-Ras were fixed with 4% formaldehyde and permeabilized with 0.1% Triton X-100. Free aldehyde groups were quenched with 50 mm NH 4 Cl. Endogenous peroxidase activity was quenched by treatment with 3% H 2 O 2 in methanol for 15 min. Fixed cells were blocked in blocking solution. Cells were incubated with anti-ha and anti-p65 for 1 hr at 37 C. Anti-mouse Alexa-594 was used to detect Ras expressing cells, whereas endogenous p65 was detected by the Tyramide-Alexa 488 system (Molecular Probes). TO-PRO staining was used to detect nuclei. Glass cover slips were mounted on mowiol and examined with Zeiss LSM 510 Meta confocal system. Quantification of positive p65 nuclear staning was determined counting 20 fields at 40X magnification of each condition. Soft agar assays To determine the ability of cells to grow in soft agar, 2 x 10 4 cells were suspended in 0.3% agar in DMEM plus 10% FCS and overlaid on 0.5% agar in the same medium. Cells were re-fed with 10% FCS-containing medium every 5 days. IKK assay IKK activity was determined in IKKγ immunoprecipitates as previously described (Leitges et al., 2001). Gene expression analysis by Q-PCR Total RNA was extracted using RNeasy purification kit (Qiagen) and DNAse treated (RQ1 DNase free, Promega), and cdna was prepared from total RNA using random primers (Promega) and the Omniscript RT kit (Qiagen). The relative levels mrna were determined by real-time quantitative PCR using an Eppendorf Realplex Mastercycler (Eppendorf) and Quantitect SYBR Green PCR kit (Qiagen). 18S mrna levels were used for normalization. Primer sequences used are as follows: FHC (5 -TCGTCGTTCCGCCGCTCCA-3 and 5 - AGCCACATCATCTCGGTCAAAA-3 ); IL-6 (5 - TTCCATCCAGTTGCCTTCTTGG-3 and 5 - TTCTCATTTCCACGATTTCCCAG-3 ); p62 (5 -CTTGTAGTTGCATCACGTAGAG-3 and 5 - CAGCATATGCACATTCAAAACTCTC-3 ); Ras (5 -GGGAATAAGTGTGATTTGCCT-3 and 5 -GCCTGCGACGGCGGCATCTGC-3 ); 18S (5 -GTAACCCGTTGAACCCCATT-3 and 5 -CCATCCAATCGGTAGTAGCG-3 ). References Barradas, M., Monjas, A., Diaz-Meco, M.T., Serrano, M., and Moscat, J. (1999). The downregulation of the pro-apoptotic protein Par-4 is critical for Ras-induced survival and tumor progression. Embo J 18, Garcia-Cao, I., Lafuente, M., Criado, L., Diaz-Meco, M., Serrano, M., and Moscat, J. (2003). Genetic inactivation of Par4 results in hyperactivation of NF-κB and impairment of JNK and p38. EMBO Rep 4, Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garcia, J.F., Camacho, F., Diaz-Meco, M.T., Rennert, P.D., and Moscat, J. (2001). Targeted disruption of the zetapkc gene results in the impairment of the NF-kappaB pathway. Mol Cell 8, Sanz, L., Diaz-Meco, M.T., Nakano, H., and Moscat, J. (2000). The atypical PKC-interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. Embo J 19,

3 Figure S1. Tumor progression in WT lung expressing Ras. WT mice were crossed with mice that developed pulmonary tumors through inducible expression of oncogenic Ras in type II alveolar epithelial cells in response to the presence of doxycycline. Hyperplasia of type II pneumocytes occurred at 14 d after induction with doxycycline in WT mice (A). Solid-type adenomas (B) and adenocarcinomas (C) appeared in WT mice after 2 months of Ras induction. Scale bar, 200 µm. Figure S2. ROS dependence of enhanced phospho-c-jun levels. Phospho-c-Jun levels were determined by immunoblotting of extracts of WT and p62 KO EFs in the presence or absence of Ras expression and BHA treatment; immunoblotting of the lower panel is an actin loading control. 3

4 Figure S3. p62 levels in KO reconstituted EFs. p62 was reintroduced in KO EFs by retroviral infection. Levels of p62 were determined by immunoblotting. 4

5 Figure S4. Nuclear RelA levels in lung expressing Ras. (A) Lung sections of WT and KO mice expressing Ras or not were stained with an anti-rela antibody to detect the presence of NF-κB in the nucleus (arrows); scale bar, 50 µm. (B) Magnifications of details of panel A; scale bar, 20 µm. These are representative samples of five sections per mouse of six mice of each condition. 5

6 Figure S5. Levels of p62 in different human tumors. (A) Protein microarray membrane with samples of different human tumors and paired normal tissues was probed with a highly specific monoclonal antibody to human p62 and with and antiactin antibody (loading control). (B) Quantification of p62 expression in each tumor tissue as compared with their respective normal controls revealed that p62 protein levels are increased in many cancers. (C) Description of different human tumors of panel (B). 6

7 Figure S6. p62 promoter sequence. The nucleotides encompassing each promoter deletion are indicated with arrows. The AP1 and NF-κB sites of the promoter are marked. 7