Supplementary Fig. 1 Generation and genotyping of ThPOK / mice

Transcription

1 Supplementary Fig. 1 Generation and genotyping of ThPOK / mice (a). The strategy used to target the ThPOK locus is schematically depicted. A targeting construct was generated by inserting a loxp site (filled triangle) in a non-conserved noncoding region 3 to the ThPOK ORF (pink filled boxes) and an frt-loxp-neo r -frt-loxp cassette upstream of ThPOK exon 2 (open triangles: frt sites). The targeted locus was obtained by homologous recombination in ES cells, and the deleted (ThPOK ) allele generated by Cre-mediated deletion of the floxed region including the neo r cassette and entire ThPOK coding sequence. Relevant restriction sites (E, EcoRV; H: HincII) and the position of probes A and B used for Southern blotting are depicted. Two-arrowhead plain

2 or dashed lines indicate the size of the restriction fragments shown in (b). The bold-faced line indicates the extent of the recombination arms in the targeted and null alleles. (b). Southern blot analyses of thymocyte DNA from wild-type (+/+), heterozygous (+/ ) and knockout ( / ) mice. DNA was prepared, digested with HincII or EcoRV as indicated, resolved on agarose gels, transferred to Hybond-XL membranes and hybridized with probes A or B depicted in panel (a). Arrowheads point to restriction fragments generated from wild-type (filled) or deleted (dashed) alleles.

3 Supplementary Fig. 2 The ThPOK allele is a null allele. (a). Lysates from 293T cells transfected with a ThPOK expression vector (right) or a control empty vector (left) were immunoblotted with the antibody used in the present study (top panels) or with a reference anti-thpok rabbit antiserum 5 (bottom panels). Arrows point to the ThPOK band. (b). ThPOK protein expression was assessed in B cells, a population that normally expresses ThPOK in low amounts and is present in ThPOK-deficient mice (data not shown). Triton X-100 lysates were prepared from spleen B cells purified from the indicated mice, and ThPOK expression was analyzed by immunoprecipitation and immunoblotting with anti-thpok rabbit antiserum. The right lane (Ab only) is an antibody-only control. Data is from two distinct experiments.

4 Supplementary Fig. 3 The CD4-Cre transgene does not affect CD4 cell development. Thymocytes from wild-type (ThPOK +/+ Gata3 +/+ ) and Gata3 ΔDP mice, and from Gata3 +/fl carrying the CD4-Cre transgene were analyzed by 3-color flow cytometry. Data is representative of three separate analyses.

5 Supplementary Fig. 4 Expression of CD5 and CD24 on redirected CD8 SP thymocytes from 5CC7 TCR transgenic mice. Overlaid histograms show expression of CD24 (top) and CD5 (bottom) on SP thymocytes from Rag2 / 5CC7 transgenic mice, either Gata3 ΔDP or Gata3 fl/fl. Plain-line traces are gated on V α 11 hi CD4 CD8 + thymocytes from Gata3 ΔDP animals and dashed-line traces on V α 11 hi CD4 + CD8 thymocytes from Gata3 fl/fl mice. Gray-filled histograms show CD5 or CD24 expression on DP thymocytes from Gata3 fl/fl mice. Data is representative of four experiments.

6 Supplementary Fig. 5 Expression of Cre does not affect lineage direction in bone marrow chimera experiments. Flow cytometry analyses of thymocytes from irradiated β2m-deficient hosts reconstituted with bone marrow from Gata3 +/+ or Gata3 ΔDP mice, or from Gata3 +/fl mice carrying the CD4-Cre transgene. Mice were analyzed 6 weeks after reconstitution. The top row shows an unmanipulated wild-type thymus. Contour plots show CD4 and CD8 expression on all (left) and TCRβ hi gated thymocytes (right) as defined in the middle dot plots. Data is from two separate experiments.

7 Supplementary Fig. 6 Expression of CD5 and CD24 on redirected CD8 SP thymocytes from Gata3 ΔDP BM chimeras. Overlaid histograms show expression of CD5 (left) and CD24 (right) on SP thymocytes from bone marrow chimeric mice (β2m-deficient recipients). Plain-line traces are gated on TCR hi CD4 CD8 + thymocytes from Gata3 ΔDP marrow (bottom) or on TCR hi CD4 + CD8 thymocytes from Gata3 fl/fl marrow (top). Gray-filled histograms are gated on the same subset of unmanipulated wild-type mice stained in the same experiment. The dashed line is gated on immature CD8 SP thymocytes from wild-type mice (defined as FSC hi TCR CD4 CD8 + ). Data is representative of two experiments.

8 Supplementary Fig. 7 Composition of CD69-purified subsets in Gata3 ΔDP and wild-type mice. Pre-purification and CD69-purified thymocytes were analyzed by 3-parameter flow cytometry for expression of CD69 (center) and CD4 and CD8 (left and right). CD69 purified cells were used for analyses shown in Fig. 4c. On center plots, plain line and gray-shaded histograms show CD69 expression on purified and pre-purification cells, respectively.

9 Supplementary Fig. 8 Expression of the ThPOK transgene. Bead purified CD4 and CD8 LN T cells ( cells), and unseparated thymocytes from ThPOK transgenic mice (1, 0.3 and cells; decreasing cell numbers indicated by wedge) were analyzed for ThPOK expression by immunoprecipitation and immunoblotting. Expression of endogenous ThPOK was not detectable in unseparated wild-type thymocytes under these conditions (data not shown). Data is representative of two experiments.

10 Supplementary Fig. 9 Peripheral T cell populations in Gata3 ΔDP mice. Splenocytes from mice expressing or lacking Gata3 and the ThPOK transgene (indicated at left) were analyzed by 3-color flow cytometry. Data is representative of three experiments.

11 Supplementary Fig. 10 Absence of CD4 T cells in neonate Gata3 ΔDP mice. Thymus (left) and spleen (right) cell populations from one week-old mice expressing or lacking Gata3 and the ThPOK transgene (indicated at left) were analyzed by 3-color flow cytometry. Each set of three mice (top and bottom) comes from a distinct litter. In these experiments, mice indicated as positive for Gata3 were either Gata3 +/fl or Gata3 +/+. The spleen data from the top litter is shown in Fig. 5c. Data is representative of two Gata3 ΔDP mice and three to five mice of each other genotype.

12 Supplementary Fig. 11 Gata3 binding sites A and B. (Top) Schematic view of the mouse ThPOK locus with the position of know cisregulatory elements 21,22. Numbers above the graph indicate exons. (Middle) Detailed view of the ThPOK genomic region containing the PRE 21, also called enhancer 22. The hatched segment indicates identity (black vertical bars) with Homo sapiens. (Bottom). The sequences of DNA segments containing two AGATAA motifs (sites A and B identified by ChIP experiments) were aligned across mammalian species. Dots indicate identity with mouse, and dashes gaps introduced for alignment. The vertical line in the site A (top) alignment stands for a 18 bp insertion (cgcccccgccccctcccc in the human sequence) present in all aligned species except mouse and rat. Alignments were obtained from the UCSC genome site, using the mouse or human sequences as queries, and adjusted after visual inspection. Note that site B is not conserved in the cat, dog and opossum sequences. Site B is the only conserved GATA motif within the PRE-enhancer, and the General T lymphoid Element 21 (GTE) does not include any evolutionary conserved GATA motif. The CGATTAG motif reported in the 5 part of the DRE is not part of the core DRE sequence required for ThPOK silencing in CD8 cells 21,22 ; whether this motif, that is only distantly related to the WGATAR canonical Gata3 binding site, binds Gata3 or contributes to the enhancer function of the DRE is not known.

13 Supplementary Table 1: oligonucleotides used for recombineering Primer Sequence (5 to 3 ) R1 gtcgtcgacagatctgtgaccattctttctc R2 gtcgaattcgatgggcagtctcagcaatgg R3 gtcgaattccacattctctatttctgagtc R4 ataagcggccgcctgacatagacatccacatac R5 gtcgacagggacacccaccacaccac R6 gatatccacgcgcgtgcacacacac R7 agatctgttaactgtgtgttacacacactctctg R8 ccaccgcggtggacccccctttgcataatttacg R9 gtcgtcgactcttgaagcctaaaccaggactc R10 gtcgatatctattctggcccataccctccc R11 gtcgatatcccaccgcggtggagcactcgcgctcttttaaag R12 ccaccgcggtgggcggccgctcgttcaggcagctcaggag R13 ccgctcgagccagaataagcactcgcgctc R14 gtcaccggtcttctcctgcagggtcaagtag R15 gatatcagaggagctgggctcagatg R16 gcggccgcgtcctcatgtgccgaggcag R17 gtcgacctcaggagatgcttcagtg R18 gaattcaagatggcggagaaaggag R19 ggatccgttgggtgtactatgcttg R20 gcggccgcgtgccaagtgaatagg

14 Supplementary Table 2: antibodies used for staining. Target Clone CD4 GK1.5 or H129 CD TCRβ H57 Vα11 RR8-1 CD CD24 M1/69 CD69 H1.2F3 CD122 TM-β1 CD44 1M7 All antibodies used for staining were from BD-Pharmingen

15 Supplementary Table 3: oligonucleotides used for ChIP assays Primers (5 to 3 ) Sense Antisense Hprt1 ttactttcgcgccctgag gcggttcattcatttccttc site A aggggtgggacttagctttttgac ccagccaccaaaagttcatctttc site B aggtgcccc ccgctcctttctc gggggttaagctcccaccaagtc E8 (I) ggattcaccattcagagagacctg agaagtagcagaggcaaccaagg

16 Supplementary Methods Cloning procedures for ThPOK targeting Gene targeting was performed using the recombineering technology and vectors ( ThPOK sequences from nucleotide (nt) to , where +1 is the A residue in the ThPOK initiation codon, were retrieved from BAC clone RP23-64L17 using recombineering arms obtained using oligonucleotides R1 to R4 (Supplementary Table 1, on line) and cloned SalI-EcoRI and EcoRI-NotI into plmj235. To insert the 3 LoxP site, we cloned recombineering arms extending from nt 1935 to 2262 and 2263 to 2619, generated using primers R5 to R8, into pltm332 (SalI-EcoRV and BglII-BstXI, respectively). Excision of the neor cassette was obtained by Cre induction in the EL350 bacterial strain. To insert the frt-loxp-neo r -frt-loxp cassette, we generated recombineering arms extending from nt -505 to -213 and -212 to 75, generated by using primers R9 to R12, into PLTM330 (SalI-EcoRV and BstXI, respectively). All recombineering arms were generated by PCR amplification from BAC DNA using Platinum Pfx (Invitrogen) and cloned into ptopo blunt (invitrogen) following the manufacturer s instructions. All PCR amplified fragments used for recombineering were verified by dideoxy sequencing. BAC transgenic constructs. We first generated a targeting cassette from picgn21, by replacing the egfp-cre coding sequence with an egfp cdna (including a translation stop codon) inserted into XhoI and SmaI sites. Two homology arms (ThPOK nt -1 to -213, and , respectively) flanking the GFP and an frt-neo-frt cassette were then cloned XhoI-AgeI

17 and EcoRV-NotI (5 and 3 from the cassette, respectively). The 5 arm provides the sequences necessary for splicing into ThPOK exon 2; the reconstituted sequence at the beginning of exon 2 is tgaccctgcaggagaagaccggtcgccaccatggtg, where the splice junction is underlined and the first GFP codon in capitals. Homology arms were obtained using primers R13 to R16 and cloned into the picgn21-derived targeting cassette. We removed the frt-neo-frt cassette using the FLPe-inducible EL250 bacterial strain, thereby generating the wild-type GFP reporter. The ΔD mutant deleted nt -620 from and was generated through similar approaches, using a loxp-neo-loxp targeting cassette from pl452, flanked by homology arms generated using primers R17 to R20 and cloned SalI- EcoRI and BamHI-NotI, respectively. We removed the loxp-neo-loxp cassette using the Cre-inducible EL350 bacterial strain. ChIP Cells were fixed with 1% formaldehyde for 10 min at room temperature with gentle agitation. Cross-linking was stopped by addition of Glycine (0.125 M final, 5 min, room temperature). Cells were collected by centrifugation and washed in cold PBS containing protease inhibitors (1mM PMSF and protease inhibitor cocktail, Roche) and lysed on ice for 10 min in 1ml of lysis buffer (Upstate Biotechnology). The chromatin was sheared by sonication with an Ultrasonic processor XL (Misonix Inc). After 10-fold dilution in Tx- 100 buffer, sonicated supernatants were pre-cleared for 1 h with protein G beads and then immunoprecipitated with anti-gata3 (HG3 31) or control mouse monoclonal IgG1 antibodies overnight. Immunoprecipitated complexes were collected on protein G beads, washed, and incubated for 4 h at 65 o C to reverse the crosslink. DNA was purified by 2

18 phenol/chloroform extraction and ethanol precipitation, and analyzed by conventional or quantitative (Sybr green) PCR with the primers listed in Supplementary Table 3, online. 3