Supporting Online Material for

Transcription

1 Supporting Online Material for Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome Daniel G. Gibson, Gwynedd A. Benders, Cynthia Andrews-Pfannkoch, Evgeniya A. Denisova, Holly Baden-Tillson, Jayshree Zaveri, Timothy B. Stockwell, Anushka Brownley, David W. Thomas, Mikkel A. Algire, Chuck Merryman, Lei Young, Vladimir N. Noskov, John I. Glass, J. Craig Venter, Clyde A. Hutchison III, Hamilton O. Smith* *To whom correspondence should be addressed. hsmith@jcvi.org This PDF file includes: Materials and Methods Fig. S1 Table S5 Reference Published 24 January 2008 on Science Express DOI: /science Other Supporting Online Material for this manuscript includes the following: (available at Tables S1 to S4

2 - 1 - Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome Materials and Methods Cassette synthesis outsourcing We contracted with Blue Heron Technology (Bothell, WA) to supply cassettes 1 to 31, 36 to 39, 52 to 88 and 90 to 101, DNA2.0 (Menlo Park, CA) to supply cassettes 32 to 35 and 40 to 51, and GENEART (Regensburg, Germany) to supply cassette 89. Each supplier verified their own sequences. The cassettes were supplied both as recombinant plasmid DNAs and as E. coli clones carrying the recombinant plasmids. Sequences, trace data, and the primers used for sequencing accompanied each cassette. Cassettes are releasable from their vector DNAs by cleavage with a Type IIS restriction enzyme. Assembly and repair by in vitro recombination Chew-back assembly (CBA) reactions (80 µl) are carried out in 250 µl PCR tubes in an MJ-Research PTC-200 thermocycler and contain 5% PEG-8000 (US Biochemicals and Fluka), 200 mm Tris-Cl ph 7.5, 10 mm MgCl 2, 1mM DTT, 100 μg/ml BSA, and 4.8 U of T4 polymerase (NEB). Each substrate DNA being assembled is typically added to a final concentration of approximately 0.5nM. This corresponds to about 200ng of a 6 kb fragment in an 80λ reaction. Incubation occurs at 37 o C for a period of time dependent on the size of the overlap. For example, a 15 minute incubation is sufficient to assemble DNA with overlaps of 300 bp while a 5 minute incubation is sufficient to assemble DNA with overlaps of bp. When numerous segments of DNA having various amounts of overlapping DNA are being recombined, the chew-back time designated for the largest overlap is used without compromising the assembly of DNA with shorter overlaps. The restriction mixture is then incubated at 75ºC for 20 min., cooled at -6 o C/min. to 60 o C and held for 30 min., then cooled at -6 o C/min to 4 o C and held. The repair (TRB) reaction (40 µl) contains 10 µl of the chew-back reaction, 40 U Taq DNA ligase (NEB), 1.2 U Taq DNA Polymerase (NEB), 5% PEG-8000, 50 mm Tris-Cl ph 7.5, 10 mm MgCl 2, 10 mm

3 - 2 - DTT, 25 μg/ml BSA, 200 μm each dntp, and 1mM NAD. Incubation is for 15 min at 45 o C. The reaction mixture is then placed on ice until analyzed. Agarose gel electrophoresis analyses of in vitro assemblies and BAC clones We found field inversion gel electrophoresis (FIGE) useful in resolving DNA up to 600 kb. We used a Bio-Rad FIGE MAPPER TM power supply. The parameters for FIGE U-5 are forward 72 V, initial switch 0.1 sec, final switch 0.6 sec, with linear ramp and reverse 48 V, initial switch 0.1 sec, final switch 0.6 sec, with linear ramp. Samples are loaded onto 0.8% E-gels (Invitrogen) and subjected to FIGE for 3 hours. The parameters for FIGE U-9 are forward 90 V, initial switch 0.1 sec, final switch 10 sec, with linear ramp and reverse 60 V, initial switch 0.1 sec, final switch 10 sec. Samples are loaded onto BioRad Ready Agarose Mini Gels and subjected to FIGE for 14 hours at 23 o C in a Hoeffer HE33 mini horizontal submarine electrophoresis tray using 1X TAE buffer with 0.5 µg/ml EtBr without circulation. Bands are visualized using a Typhoon 9410 Fluorescence Imager (Amersham) with 532 nm excitation and 610 nm emission wavelengths and a BioRad Gel Doc. BAC preparation for in vitro assembly reactions The Phusion high-fidelity DNA polymerase kit (NEB) was used to PCR-amplify twentyfive A-series, eight B-series, and four C-series BACs. To generate overlaps, pcc1bac (EPICENTRE) was PCR-amplified using primers situated near the BamH I cloning site. For example, to create a BAC used in the A66-69 assembly, primer 66 and primer 69 are used. Primer 66 (68 bp) contains an overlap with the first 40 bp of cassette 66, followed by a Not I site and then a 20 bp overlap with the vector to the right of the BamH I site. Primer 69 (68 bp) contained an overlap with the last 40bp of cassette 69 followed by a Not I site and then a 20 bp overlap with the vector to the left of the BamH I site. Prior to assembly, PCR products are gel-purified. Cloning the assembled cassettes in E. coli and cloning efficiencies Three microliters of the TRB reaction is electroporated into 30λ EPI300 E. coli cells (EPICENTRE) at 1200V in a 1mm cuvette with a capacitance of 25μF and a resistance of

4 Ω using a Gene Pulser Xcell Electroporation System (BIO-RAD catalog # ). Cells are recovered in 1ml SOC for 2 hours at either 30 o C or 37 o C then plated onto LB agar μg/ml chloramphenicol at either 30 o C or 37 o C. Three microliters of an A-series TRB reaction containing 5 segments of DNA (four cassettes and one PCR-amplified BAC) typically yields about 1000 colonies but may yield as many as 20,000 colonies (SOM Table 1). In general, when BAC DNA is prepared from 10 colonies then digested with Not I, all have the correct insert size. Three microliters of a B-series TRB reaction containing 4 segments of DNA typically yields about 500 colonies. Approximately 50-75% of these clones contain a BAC with the correct insert size. Three microliters of a C-series TRB reaction typically yields about 150 colonies. Approximately 50-75% of these clones contain a BAC with the correct insert size. The drop in cloning efficiency from A- to C-series assemblies is most likely the result of decreased circle formation due to concatemerization of the larger DNA molecules. Carry over of the chloramphenicol resistance marker from undigested input DNA in the assembly reactions seems to be the explanation for the decrease in percentage of correct recombinants in the second and third rounds of assembly. Colony size tended to decrease with larger inserts. Series No. fragments Approximate Typical no. Percent correct assembled insert size colonies insert size A 5 6 kb B 4 24 kb C 3 72 kb SOM Table S5: Efficiency of assembly and repair by in vitro recombination. Numbers given are for transformation of 7.5% of a repaired reaction. Up to 20,000 colonies were observed for the A-series assemblies. Generally ten colonies were chosen for analysis of insert size. Critical in vitro assembly parameters The assembly method described here is generally quite robust. However, there are three important considerations. First, an unrepaired assembly reaction will only yield a few

5 - 4 - colonies if transformed, emphasizing the importance of repair synthesis. Second, it is important to add equimolar amounts of DNA being assembled. If the number of DNA molecules is not balanced, premature termination of assembly may result. Third, in order to reduce the number of mutations introduced during PCR amplification of vector DNA, a high-fidelity DNA polymerase such as Phusion DNA polymerase should be used. Yeast transformation Transformation of yeast cells during TAR cloning was performed using a published method (1). Briefly, yeast cells were harvested from an overnight culture and washed with water, then 1 M sorbitol. Cells were converted to spheroplasts by treatment with zymolyase and ß-mercaptoethanol in the presence of 1 M sorbitol. The spheroplasts were washed with sorbitol and resuspended in a buffer containing sorbitol and CaCl 2. Spheroplasts equivalent to 5 ml of original yeast culture were incubated in a 200 µl volume at room temperature for 10 min with 10 ng of vector and 120 ng of each 1/4 genome. Then 800 µl of 20% polyethylene glycol (PEG) 8000 (US Biochemicals) was added and incubation continued for 10 min. After recovery in rich medium, the transformed cells were selected at 30ºC in top agar on sorbitol plates in the absence of histidine. TAR cloning of the entire synthetic M. genitalium genome from four quarter genomes produced 140 colonies. Yeast transformant analysis Yeast transformants were screened initially by two rounds of multiplex PCR. The first round (SOM Figure 1A) tested for the presence of an amplicon within each of the DNA fragments used in TAR cloning, which was five synthetic M. genitalium fragments (C1-24, C25-49, C50-77 cleaved into two fragments by BsmBI, and C78-101) and the TARBAC vector. A portion of the yeast rdna sequence was amplified as a positive control. Thirty-five of 94 transformants screened were positive for all 7 amplicons. These transformants were next screened for the presence of M. genitalium sequence about every 30 kb across the genome. This was done using two sets of 10 amplicons, which ranged in size in 100 bp increments from 100 to 1000 and 150 to 1050 bp (SOM Figure 1B). Twenty-five out of 35 transformants screened were positive for all 20 amplicons. Both

6 - 5 - assays were performed with the QIAGEN Multiplex PCR Kit. Clones positive for amplification of all input fragments were restreaked for single colonies and then characterized by Southern Blot (SOM Figure 1D). Total yeast DNA was prepared in an agarose plug (as per the BioRad CHEF DRIII manual protocol), Not I-digested to separate vector from M. genitalium sequence, resolved by pulsed-field gel electrophoresis (Bio-Rad CHEF DRII or DRIII), transferred by vacuum (BioRad Model 785 Vacuum Blotter) to an Amersham Hybond-N+ membrane, probed with a mix of two digoxigeninlabeled (Roche) PCR products that hybridize within the nine M. genitalium MgPa repetitive regions and detected with anti-digoxigenin-ap Fab fragments followed by the fluorescent substrate HNPP (Roche). Primers used to amplify the probes had the following sequences: TTCTAACATCAATGTTGGG and CTGCGGGTTATTCTTATTAG and CAAACCATCCATAACACCAAC and TCCACCCACTACTATCCTTCC. Desirable clones showed a single band of the same size as chromosomes resolved from an agarose plug of native M. genitalium genomes. This was 17 of the 23 clones screened. Eleven of these clones were then re-screened by the two PCR assays, since the original PCR was performed on possibly mixed clones (SOM Figure 1C). All were positive for all 27 amplicons. These eleven clones were restreaked and 4 subclones of each subjected to NotI digestion and Southern Blot analysis as described; all of these clones were stable. Sequencing of the two cloning hooks showed that 7 out of 11 of these clones had the correct sequence. This screening was performed because the long, unpurified oligos used in PCR amplification of the TARBAC were likely to contain errors. Recovery of the synthetic M. genitalium genome from yeast for sequencing smgtarbac37 cells were prepared in agarose plugs and treated to release the DNA according to the Bio-Rad CHEF protocol for yeast. A 1.5 L CM-HIS culture was grown at 30ºC to an OD 600 of 0.5. The plugs were washed and dialyzed in 1X NEB buffer 4, then incubated overnight at 37ºC with restriction enzymes Rsr II, Fse I, and AsiS I, which cleave yeast but not smgtarbac37. Digested linear yeast DNA was removed from plugs by agarose gel electrophoresis at 6.3 V/cm for 2 hours. Intact circular smgtarbac37 DNA remained in the plug under these conditions. To evaluate the size

7 - 6 - and purity of the smgtarbac37 DNA one plug was incubated with Not I and the DNA in the plug was analyzed by electrophoresis. Fig. 6 shows a band of approximately 583 kb with Not I digestion, and a faint band in the undigested control. DNA from the remaining plugs was used to prepare a library for sequencing. Reference 1. N. Kouprina, V. N. Noskov, V. Larionov, Methods Mol Biol 349, 85 (2006).

8 A L (+) (-) L bp C1-24 yeast rdna C lg frag C50-77 TARBAC C25-49 sm frag C B clone L L L L C Set 1 Set 2 L A B C D E F G H I J A B C D E F G H I J D kb SOM Figure 1. Yeast TAR cloning transformant analysis. See text for additional details. A. The first round of screening with multiplex PCR is shown for a subset of clones. Negative ((-), no template) and positive ((+), a mix of host strain VL6-48N, TARBAC, and native M. genitalium DNAs) controls are marked, as is the 100 bp ladder (L, Invitrogen). B. The second round of screening with multiplex PCR is shown for ten clones that were positive for all seven amplicons in the first round. The ladder is marked as in part A. C. Results of both rounds of multiplex PCR for smgtarbac37. Lane 1: round 1; lane 2: round 2 set 1; lane 3: round 2 set 1, 4 largest amplicons only; lane 4: round 2 set 2; lane 5: round 2 set 2, 4 largest amplicons only. The ladder is marked as in parts A and B. D. Clones positive for all PCR amplifications were screened for size. The left panel shows pulsed-field electrophoresis and the right shows the blot of this gel. Lanes are as follows: 1 and 28) Low-range pulsed field gel marker (NEB), 2) Host yeast strain VL6-48N, undigested, 3) VL6-48N, Not I-digested, and 4) Native M. genitalium. Although this genome is circular, a fraction of the molecules in the agarose plug are broken and these linear molecules electrophorese at about 600 kb, providing a size marker and a blot signal control for the TAR clone. Lanes 5-27 are NotI-digested TAR clones. smgtarbac37 is in lane 11.