To remove S-tag and enterokinase cleavage site from pet-32a, PCR was carried out using

Transcription

1 Supporting Information Creation of a type 1 blue copper site within a de novo coiled-coil protein scaffold Daigo Shiga, Daisuke Nakane, Tomohiko Inomata, Yasuhiro Funahashi, Hideki Masuda, Akihiro Kikuchi, Masayuki Oda, Masanori Noda, Susumu Uchiyama, Kiichi Fukui, kenji Kanaori, Kunihiko Tajima, Yu Takano, Haruki Nakamura, Toshiki Tanaka 1) DNA sequence for AM2C and construction of pet-s(-)-am2c 2) Purification of AM2C 3) Analytical ultracentrifugation analysis 4) Time course of blue color decay from the AM2C-Cu 2+ complex 5) ESI-TOF-MS 6) Redox potential measurement 7) 3D model 1) DNA sequence for AM2C and construction of pet-s(-)-am2c To remove S-tag and enterokinase cleavage site from pet-32a, PCR was carried out using 5 GCTCTAGAAATAATTTTGTTTAAC3 (Xba I site underlined) and 5 CCCCCATGGCAGAACCGCGTGGCACCAGAC3, which is complementary to the DNA sequence before S-tag of pet32a (Nco I site underlined) as primers. The PCR fragment was hydrolyzed by Xba I and Nco I and inserted into a large fragment of Xba I and Nco I sites of pet-32a to obtain pet32-s(-). The DNA sequence around AM2C was shown Figure S1 as well as the amino acid sequence and restriction enzyme sites of AM2C corresponds to the region between Nco I and Hin diii sites. The Histag and thrombin cleavage site are present in front of AM2C. Genes for AM2C were prepared by three PCRs using fourteen oligonucleotides as primers (Figure S2). Using the primer 3,4,7, and 8 for the PCR, 132bp fragment was isolated by 1% agarose gel electrophoresis. Then the PCR reaction was carried out using this fragment and the primer 1, 2, and 5 to afford the 222 bp fragment, which was isolated by 1% agarose gel electrophoresis. Likewise, The PCR using the primer 10,11, 13, and 14 gave the 132 bp fragment. The PCR reaction using this fragment and primer 8, 9, and 12 gave the 226 bp fragment. Finally, using the 222 bp fragment, the 226 bp fragment, primer 1 and the primer 12, the PCR was S1

2 carried out to obtain the 432 bp fragment containing the gene for AM2C. This fragment was treated with Nco I and Hin diii, and the resultant fragment was inserted into a large fragment of Nco I-Hin diii site of pet32-s(-) to obtain pet32-s(-)-am2c. The DNA sequence of AM2C was confirmed by the dideoxy sequencing method. Figure S1. Amino acid and DNA sequences of AM2C. Restriction sites were indicated below the nucleotide sequence. His-tag sequence and thrombin cleavage site were indicated by the dotted boxes. To construct the gene for AM2C, we used the following fourteen oligonucleotide. The forward and the reverse primers were indicated by f) and r), respectively. Primer 1, f) 5 -ggcgaattcgccatggctaaacaaattgaagacaaattggaggagatttt -3 (underlines indicate the Eco RI and Nco I sites from left to right) Primer 2, f) 5 - gacaaattggaggagattttgagtaagcattatgctgccgaaaacgagt -3 Primer 3, f) 5 -tatgctgccgaaaacgagttagctagaattaaaaaattgctcggggagg -3 S2

3 Primer 4, f) 5 - aaaaaattgctcggggagggaggtaccggaggaggattgttgaaaaaaat -3 (underline indicates Kpn I site) Primer 5, r) 5 -tcctccggatccaccttgtatctcgtctttcaactcctcaatcaaacttt -3 (underline indicates Bam HI site) Primer6, r) 5 -caactcctcaatcaaacttttgcaataagctgcctcattttcgagtgct -3 Primer 7, r) 5 -tgcctcattttcgagtgctctaatttttttcaacaatcctcctccggta -3 Primer 8, f) 5 -aggtggatccggaggaaagcagatcgaggataagctggaagaaatactttcaaa -3 (underline indicates Bam HI site) Primer 9, f) 5 -ctggaagaaatactttcaaagcactacgctgctgagaatgaacttgcac -3 Primer 10, f) 5 -gctgagaatgaacttgcacgaatcaaaaagctacttggcgaaggcggcc -3 Primer 11, f) 5 -ctacttggcgaaggcggcctgcagggcggccttcttaagaagatccgagc -3 (underline indicates Pst I site) Primer 12, r) 5 -gccaagcttttactaagatctctggatttcatctttaagttcttcgata -3 (underline indicates Hin diii site) Primer 13, r) 5 -atctttaagttcttcgataagtgacttagcgtaagcggcttcgttctct -3 Primer 14, r) 5 -gtaagcggcttcgttctctaatgctcggatcttcttaagaaggccgccc -3 1st PCR fr. 3 fr. 4 fr. 10 fr. 11 fr. 7 fr. 6 fr. 14 fr. 13 2nd PCR fr. 1 fr bp fr. fr. 8 fr.9 132bp fr. fr. 5 fr. 12 3rd PCR fr bp fr. 226bp fr. fr. 12 Figure S2. Scheme of construction of the gene for AM2C using the 14 oligonucleotides by the three steps of PCRs. S3

4 2) Purification of AM2C Figure S3. Each steps of the purification of AM2C by 15% SDS PAGE analysis. Lane 1, size marker; lane 2, the supernatant fraction after sonication of the E. coli cell ; lane 3, the flow through fraction after applying the Ni affinity column; lane 4, the fraction eluted by the binding buffer; lane 5, the elution fraction after thrombin treatment; lane 6, after HPLC purification. S4

5 3) Analytical ultracentrifugation analysis Figure S4. Sedimentation velocity experiments under reducing condition. Experiments were performed for 100 M AM2 in 20 mm sodium phosphate, 250 mm NaCl, ph 7.5 containing 10 mm TCEP (Tris [2-carboxyethyl] phosphine hydrochloride). Runs were carried out at 60,000 rpm and at a temperature of 20.0 C using 12 mm aluminum double sector centerpieces and four-hole An60 Ti analytical rotor equilibrated to 20.0 C. M and D indicate the peaks corresponding to the monomer and the dimer of AM2C, respectively. S5

6 4) Time course of blue color decay from the AM2C-Cu 2+ complex Figure S5. Time course of the UV-vis spectral change of the AM2C-Cu 2+ complex. Initial concentrations of AM2C and Cu 2+ were 100 µm in 50 mm PIPES-NaOH buffer at ph 7.5. inlet: Absorbance at 616 nm was plotted as a function of time. S6

7 5) ESI-TOF-MS Figure S6. ESI-TOF MS spectra of colored (a) and color-faded AM2C (b). The assignment of series of charge states enabled the calculation of the masses. Each molecular mass corresponds to the value of highest peak with indicated ion charge state. (c) Enlarged signals of the 11+ charge state of colored (solid line) and color-faded (dotted line) AM2C. (d) Deconvoluted molecular masses for series of charge states for colored ( ) (solid line) and color-faded AM2C ( ) (dotted line). S7

8 6) Redox potential measurement Figure S7. a) The cyclic voltammograms of AM2C-Cu 2+ were recorded by a Hokutodenko HZ-5000 electrochemical analyzer. The sample was prepared at AM2C concentration of 700 µm and Cu 2+ of 600 µm, which was dissolved in 50 mm PIPES-NaOH (ph 7.5) and 500 mm NaCl. The sample solution was purged with Ar, and the its redox potential was measured under Ar flow with a plastic formed carbon electrode (PFCE) (BAS Inc.) as a working electrode, a Ag/AgCl (3M NaCl) reference electrode, and a Pt wire as a counter electrode. The scan rates were 10 (dash-dotted line), 50 (broken line), 100 (dotted line), and 200 mvs -1 (solid line). The anodic and cathodic potentials were indicated by vertical bars in the figure. The redox potential was converted to NHE by the addition of +199 mv. The obtained redox potential and the peak separation of redox ( E p ) were 328 mv and 63 mv, respectively. b) The cyclic voltammograms of CuCl 2 (600 µm) in 50 mm PIPES-NaOH (ph 7.5) and 500 mm NaCl was recorded as a reference with a scan rate of 50 mvs -1. S8

9 7. 3D model Figure S8. Packing of each layer of the minimized structure of the model of the AM2C-Cu 2+ complex. Internal amino acid residues are represented by spheres. S9