A Role for Focal Adhesion Kinase in Phenylephrine-Induced Hypertrophy of Rat Ventricular Cardiomyocytes.
|
|
- Nelson Simon
- 1 years ago
- Views:
Transcription
1 JBC Papers in Press. Published on April 3, 2000 as Manuscript M A Role for Focal Adhesion Kinase in Phenylephrine-Induced Hypertrophy of Rat Ventricular Cardiomyocytes. Joan M. Taylor, Joshua D. Rovin and J. Thomas Parsons * Department of Microbiology, Health Sciences Center, University of Virginia Charlottesville, Virginia, * To whom correspondence should be addressed: J. Thomas Parsons Department of Microbiology Box 441, Health Sciences Center University of Virginia Charlottesville, VA tel. # : (804) fax #: (804) Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
2 The abbreviations used are: MAP, mitogen-activated protein; EGF, epidermal growth factor; PDGF, platelet-derived growth factor; GRB2, growth receptor bound protein-2; PAGE, polyacrylamide gel electrophoresis; EGTA, ethylenebis(oxyethylenenitrilo)-tetraacetic acid; PBS, phosphate-buffered saline; TBS, tris-buffered saline; RIPA, radioimmunoprecipitation assay buffer; Ab, antibody; Mab, monoclonal antibody; HRP, horseradish peroxidase; PE, phenylephrine; FAK, focal adhesion kinase; ECM, extracellular matrix; ANF, atrial naturetic factor; FRNK, FAK related non-kinase; PI3 Kinase, phosphoinositide 3-kinase; CAS, p130 Crk associated substrate; ERK, extracellular signal regulated kinase; BrdU, 5-Bromo-2 - Deoxyuridine, DMEM, Dulbecco s modified eagles medium; GFP, green fluorescent protein; JNK, Jun NH2-terminal kinase; MEK, mitogen activated kinase kinase; FN, fibronectin; LAM, laminin; COL, collagen; MBP, myelin basic protein. Running title : FAK regulates myocyte hypertrophy Keywords : integrins, cardiomyocyte, heart, hypertrophy, FAK, FRNK, adenovirus 2
3 ABSTRACT A variety of agonists including phenylephrine (PE) induce hypertrophy in neonatal ventricular cardiomyocytes. Here we report that signals provided by extracellular matrix proteins (ECM) augment the PE-induced hypertrophic response of cardiomyocytes and provide evidence that ECM-dependent signaling is mediated in part by the protein tyrosine kinase, focal adhesion kinase (FAK). Addition of PE to cultured neonatal cardiomyocytes stimulated sarcomeric organization, increase in cell size, and induction of atrial naturetic factor (ANF) in cardiomyocytes plated on the ECM protein laminin or fibronectin. In contrast, cardiomyocytes plated on the non-adhesive substrate gelatin exhibited a reduced capacity to undergo these PEstimulated hypertrophic changes. In cardiomyocytes cultured on ECM, PE stimulated a rapid increase in tyrosine phosphorylation of focal adhesion proteins including FAK, paxillin and p130 Crk associated substrate (CAS) and subsequent formation of peripheral focal complexes. Inhibition of the PE-induced hypertrophic response by genestein and herbimycin-a indicated a requirement for protein tyrosine kinases in PE signaling. To determine whether activation of FAK is required for PE-induced hypertrophy a dominant-interfering mutant form of FAK; termed FRNK (FAK-related non-kinase) was ectopically expressed in cardiomyocytes using a replication-defective adenovirus expression system. FRNK expression attenuated PEstimulated hypertrophy as assessed by cell size, sarcomeric organization and induction of ANF. These data indicate that the signal transduction pathways leading to cardiomyocyte hypertrophy are strongly influenced by and/or dependent upon an integrin-mediated signaling process requiring FAK. 3
4 INTRODUCTION Cardiomyocyte hypertrophy, characterized by increased volume and myofibrillar protein content, is important for the normal developmental growth of the heart. However, in the fully developed adult heart, pressure or volume overload, myocardial infarction or hormonal imbalance can lead to chronic pathological hypertrophy characterized by induction of immediate early genes, re-activation of an embryonic gene program, and reorganization of myocyte cytoskeletal architecture (1). The ability of integrins, extracellular matrix receptors, to regulate cytoskeletal architecture has been well characterized and integrin signaling has clearly been implicated in hormone and growth factor-induced alterations in gene transcription in variety of cell types (2). Integrins are a family of heterodimeric transmembrane receptors (composed of α and β subunits) containing extracellular ligand binding domains that show binding specificity for extracellular matrix (ECM) components and a short cytoplasmic domain that serves to couple integrins with the actin cytoskeleton (3). Several studies have shown that cardiac hypertrophy is accompanied by alterations in ECM components and cardiac integrin expression (4-6). Specifically, enhanced expression of collagen III, fibronectin, osteopontin, and β 1, α 3 and α 5 integrin subunits correlates with advancement of hypertrophy (4-6). A direct role for integrins in the development of hypertrophy has been demonstrated by transgenic studies in which cardiac specific expression of activated α5 integrin leads to profound ventricular hypertrophy (7). Taken together, these observations support a model whereby alterations in signaling pathways responsive to ECM may 4
5 influence the progression of cardiac hypertrophy. Integrin signaling in many cell types involves activation of focal adhesion kinase (FAK), a cytoplasmic non-receptor protein tyrosine kinase. Clustering of integrins leads to the recruitment of FAK to the newly formed focal adhesion and results in autophosphorylation and concomitant activation of FAK. Tyrosine phosphorylation of FAK at Tyr397 (proximal to the kinase domain) creates a binding site for the SH2 domain of another non-receptor tyrosine kinase, Src, resulting in formation of a bipartite complex of two tyrosine kinases (8). The formation of the FAK/Src complex results in the activation of Src and the subsequent activation of downstream signals leading to the regulation of cellular processes such as growth, migration and apoptosis (2,3,9). The C-terminal domain of FAK contains binding sites for a number of signaling molecules including phosphoinositide 3-kinase (PI3 kinase), p130 Crk associated substrate (CAS), GRB2, paxillin and the GTPase regulator associated with FAK (Graf; ref 10). The recruitment and activation of these molecules are thought to be important for the subsequent activation of other downstream signaling pathways. For example, association of FAK with CAS is required for integrin-mediated activation of ERK2 (11). In some cells, the C-terminal domain of FAK is expressed as a separate protein termed FRNK (FAK-related non kinase), whose overexpression attenuates integrin-mediated tyrosine phosphorylation of FAK and paxillin (12,13) and results in the inhibition of the rate of cell spreading and cell migration (12,13). These data indicate that FRNK can act as a biological inhibitor of FAK signaling and highlight the importance of FAK in ECM-mediated signaling events. In addition to providing specific signaling from ECM, recent evidence suggests that 5
6 integrin engagement is required to mediate efficient growth factor and hormonal-mediated signaling. When fibroblasts are held in suspension, EGF-, PDGF- and lysophosphatidic acidstimulated ERK2 activity is markedly reduced compared to cells plated on fibronectin (14,15). Importantly, the inhibition observed in suspended cells can be rescued by over-expression of activated FAK (16). These data indicate that growth factors (or hormones) synergize with cell adhesion signals to stimulate cell growth and survival. We report herein that PE-induced hypertrophy in isolated neonatal cardiomyocytes requires signaling through FAK. Plating cells on the integrin-dependent ECM proteins laminin or fibronectin supports the PE-induced hypertrophic response of the cultured cardiomyocytes, whereas plating cells on the integrin-independent substrate gelatin fails to sustain cellular hypertrophy. Addition of PE stimulates tyrosine phosphorylation of focal adhesion proteins including FAK, paxillin and CAS and alters the subcellular localization of paxillin in cardiomyocytes plated on ECM. In addition, we show that ectopic expression of FRNK, a dominant-interfering mutant for FAK, attenuates PE-induced hypertrophy. These data support a role for integrin-mediated, FAK-dependent signaling for induction of cardiac hypertrophy. 6
7 EXPERIMENTAL PROCEDURES Antibodies Antibody (9E10) to the myc-epitope tag was purchased from Santa Cruz Biotechnology; the anti-anf antibody (IHC9103) from Peninsula Laboratories; the 4G10 phosphotyrosine specific antibody from Upstate Biology; the anti-paxillin antibody from Transduction Laboratories and the anti-gfp antibody from Clontech. An anti-fak tyrosine 397-specific antibody was purchased from Biosource International and an anti-human FAK antibody was purchased from UBI. The ERK1/2 antibodies used include a phosphorylation-specific antibody purchased from Calbiochem and polyclonal (TR10) and monoclonal (1B3B9) antibodies generously provided by Dr. Michael Weber (University of Virginia). CAS was detected using a mixture of two polyclonal antibodies generated against the C-terminal domain of CAS (CAS-F and CAS-P; provided by Dr. Amy Bouton, University of Virginia, ref 17). Expression Constructs and Adenovirus Production The cdna constructs encoding the amino-terminal Myc- and GFP-tagged variants of FRNK were generated by cloning chicken FRNK into the BamHI/NotI or BglII/EcoRI sites of the mammalian expression vectors pcmv-neo-bamhi or pegfp-c1 respectively. For adenovirus production, GFP and GFP-tagged FRNK were generated by PCR from pegfp-c1 and pegfp- 7
8 C1-FRNK respectively using primers that added 5 and 3 BamHI restriction sites. The resultant PCR products were digested with BamHI and ligated with BamHI digested pad-lox (an adenoviral shuttle vector generously provided by Stephen Hardy, Somatix Therapy Corporation, Almeda CA). Correct orientation of all reading frames were confirmed by sequencing and western blot analysis of expressed proteins. The GFPAd-lox and GFP-FRNKAd-lox constructs were subsequently co-transfected with replication-defective ψ5 virus into HEK293 cells that produce stable overexpression of the Cre-recombinase. After recombination, plaque purified virus (1 x 1010pfu/ml) was generated and purified by cesium-chloride gradients as described elsewhere (18). Cell Culture, Infection and DNA Transfection Ventricular cardiomyocytes were isolated from neonatal rats (1-3 days old) by trypsin and collagenase digestion and purified as previously described (19). The cells were resuspended in DMEM:Media 199 (4:1) containing 10% fetal calf serum and 1% penicillin-streptomycin and plated on tissue culture plastic for two consecutive 1 h periods followed to remove noncardiomyocyte cells. For the biochemical experiments, cardiomyocytes were treated with 100 µm BrdU as described previously to obtain cultures with >95% myocytes (20). The cardiomyocytes were then plated on tissue culture dishes or chamber slides pre-coated with ECM or gelatin as required. Cardiomyocytes were plated at low density (2 x 10 4 cells/ml) for immunofluorescent studies and at high density (1 x 10 6 cells/ml) for biochemical studies. After h the cells were rinsed in serum free DMEM:Media 199 (4:1) and plated in serum free DMEM:Media 199 (4:1) containing 1% penicillin-streptomycin. After a 24 h incubation period, cells were treated with vehicle or PE for the indicated time periods. 8
9 For adenoviral infection, cells were infected in serum free media with either GFP or GFP-FRNK (4 MOI) for 12 h prior to treatment with PE. In some experiments cardiomyocytes were transfected with a myc-frnk expression vector using the FuGene transfection reagent (Boehringer Mannheim). Typically 3 µg of DNA/20 mm chamber slide was combined with 6 µl FuGene and incubated with the cells in serum free DMEM:Media 199 (4:1) for 24 h prior to treatment with vehicle or PE. Immunocytochemistry For immunofluorescent staining, cells were washed three times with phosphate-buffered saline (PBS, calcium and magnesium free) and fixed using 4% paraformaldehyde in PBS for 20 min at RT. Cells were washed three times in PBS and permeabilized with 0.4% Triton X-100 in PBS for 3 min at RT. Slides were then washed three times in PBS to remove the detergent and incubated with the either the primary anti-myc monoclonal antibody, 9E10 (1µg/ml) or the polyclonal anti-anf Ab (1:500, Peninsula Laboratories) for 1 h. Cells were washed three times in PBS and incubated with Cascade-blue conjugated Goat anti-mouse Ab (2µg/ml) and/or Texas- Red conjugated Donkey anti-rabbit Ab (2 µg/ml) for 1h. In some experiments, Texas Red- or FITC-conjugated phalloidin (1:1000; Molecular Probes) was used to visualize filamentous actin. Immunoprecipitation and Western blots Cardiomyocytes were lysed by homogenization in a modified RIPA buffer (50 mm Hepes, 0.15 M NaCl, 2 mm EDTA, 0.1% NP-40 and 0.05% sodium deoxycholate, ph 7.2) containing 1 mm Na 3 VO 4, 40 mm NaF, 10 mm Na 2 pyrophosphate. Paxillin or CAS or ERK1/2 were 9
10 immunoprecipitated by incubation of 1 to 2 mg cell extract with 5 µg of the appropriate antibody for 2 h at 4 C, followed by a 1 h incubation with Protein A-sepharose conjugated beads (Pharmacia). For paxillin immunoprecipitation the beads were pre-coupled to rabbit anti-mouse antibody (10 µg/ml, Jackson Laboratories). The immune complexes were collected by centrifugation, the beads were washed three times with RIPA buffer and once with TBS buffer (0.2 M NaCl and 50 mm NaCl, ph 7.4), boiled in sample buffer and the proteins resolved by 10% SDS-PAGE. Proteins were transferred to nitrocellulose, and Western blots were performed using the appropriate primary antibody at a 1/1000 dilution followed by incubation with either HRPconjugated rabbit anti-mouse Ab or HRP-conjugated Protein A-sepharose (Amersham) at a 1/1000 dilution. Blots were visualized after incubation with chemiluminescence reagents (ECL, Amersham). Immune Complex Kinase Assay ERK was immunoprecipitated by incubation of cardiomyocyte extracts (100 µg) from GFP or GFP-FRNK infected cells with a polyclonal antibody specific for ERK1 and ERK2 (TR10) as described above. The immune complexes were resuspended in MAP kinase reaction buffer (25mM Hepes, ph 7.5, 10 mm magnesium acetate, and 50 µμ unlabeled ATP) containing myelin basic protein (2 µg) and [γ- 32 P]ATP (1 µci, 6000 Ci/mmol) and incubated at 30 C for 20 min. The reaction mixtures were boiled in SDS sample buffer, resolved by 15% SDS-PAGE and visualized by autoradiography. ANF Secretion Cardiomyocytes were isolated as previously described and plated at a density of 2.5x10 5 cells/well in a 24-well plate. Cells were treated with either GFP virus or GFP-FRNK virus (4 MOI) or 10
11 vehicle control in serum free media (300 µl/well). 12 h after infection, cells were treated with either vehicle alone or 100 µm PE for 24 h. The conditioned media was collected and centrifuged to pellet any possible debris. The concentration of ANF in the conditioned media was then determined using a peptide enzyme immunoassay (Peninsula Laboratories, San Carlos, CA). RESULTS Many features of pathological hypertrophy can be reproduced in isolated neonatal cardiomyocytes by treatment with a variety of agents including phenylephrine (PE), angiotensin II, and endothelin-1 (21). These cells respond by an increase in cell size, sarcomeric organization, increased expression of immediate early genes (c-fos, c-jun, Egr-1, jun-β and Nur-7) and re-expression of embryonic genes (atrial naturetic factor; ANF; skeletal α actin, smooth muscle α-actin and β-myosin heavy chain; ref. 22). Using this experimental paradigm, we examined to what extent integrin-mediated signaling is involved in the hypertrophic response in vitro. Initially, we examined the ability of PE to stimulate hypertrophy in neonatal cardiomyocytes plated on integrin-dependent (e.g. laminin, fibronectin and collagen type I) or integrin-independent (e.g. gelatin) substrates. PE treatment of cardiomyocytes plated on laminin 11
12 (Fig.1A, middle panels) stimulated sarcomeric organization, increase in cell size and ANF production compared to control, vehicle treated cells (Fig 1A, top panels). In contrast, cardiomyocytes plated on gelatin exhibited a reduced capacity to undergo these PE-stimulated hypertrophic changes (Fig 1A, bottom panels). To quantitate the extent of hypertrophy on different matricies, a total of cells in each treatment group (representing cells from three separate experiments) were scored for sarcomeric organization and ANF induction using fluorescent microscopy (Fig. 1B). Sarcomeric reorganization was observed in approximately 90% of PE-treated cells plated on laminin versus 35% of the cells plated on gelatin. Cells not treated with PE showed little actin reorganization whether plated on laminin or gelatin ( Fig. 1B, left panel). ANF production was observed in approximately 70% of PE-treated cells plated on laminin compared to 15% of the cells plated on gelatin. Fibronectin supported PE-stimulated sarcomeric reorganization and ANF production to a similar extent as laminin, whereas type I collagen was far less efficient in supporting these hypertrophic responses (Fig 1B). Thus these initial experiments provide support for the role of ECM-directed integrin signaling in PE-induced hypertrophy. Since maximal PE-induced cardiomyocyte hypertrophy required ECM, we examined whether components of the integrin-signaling cascade were altered after PE stimulation. First we examined whether PE treatment altered the subcellular localization of focal adhesion proteins during the hypertrophic response. Fig. 2 shows immuostaining of actin stress fibers and the focal adhesion protein paxillin during the progression of PE-induced hypertrophy in cells plated on laminin. Typically, cellular changes indicative of hypertrophy including increases in cell size and sarcomeric organization are complete within hours after PE treatment in cultured 12
13 neonatal cells. As shown in Fig. 2A, myofibrillar reorganization was enhanced relative to controls as early as 1h after PE treatment and the organization was virtually complete by 4 h. The recruitment of the focal adhesion protein paxillin to complexes at the periphery of cells appeared to be concomitant with the enhanced sarcomeric reorganization (Fig. 2B). Paxillin staining was generally dispersed in untreated cells but after 1 h of PE treatment, staining appeared more focal in nature, localized to the periphery of cells. At 4 h of PE treatment paxillin appeared in distinct complexes at the termini of actin fibers. A similar staining pattern was observed with antibodies directed against another prominent focal adhesion protein, vinculin (data not shown). The PE-stimulated paxillin complexes observed in cardiomyocytes are reminiscent of (albeit smaller than) classical focal adhesions observed following plating of fibroblasts or epithelial cells on ECM proteins and suggest that PE treatment is giving rise to a rearrangement of the ECM-adhesion structures. Tyrosine phosphorylation is a critical covalent modification driving protein-protein interactions required for cytoskeletal reorganization and focal adhesion assembly (10). As shown in Fig. 2B, PE treatment of cultured cardiomyocytes induced the formation of phosphotyrosine-rich focal adhesion-like complexes at the periphery of cells similar to that observed for paxillin immunostaining. To determine the kinetics and extent of tyrosine phosphorylation of focal adhesion associated proteins, FAK, and CAS were immunoprecipitated from PE-treated cells and analyzed by Western blotting with anti-phosphotyrosine (ptyr) antibodies. As shown in Fig. 3, cells plated on fibronectin, but not gelatin exhibited a PEstimulated, time-dependent increase in tyrosine phosphorylation of FAK (Fig. 3, panel A). Typically, an increase in FAK ptyr is observed within 5-10 min after treatment with PE and is 13
14 sustained for at least 30 min. A similar PE-induced tyrosine phosphorylation of the FAK binding partners, CAS and paxillin were also observed when cells were plated on fibronectin (Fig 3 panels B and C) but not gelatin (data not shown). Importantly, as shown in Figure 3D, PE-induced activation of the downstream signaling molecule ERK2 is also dependent on ECM interactions. Although variability is observed in the onset of ERK phosphorylation (ranging from 5-10 min) a consistent correlation is observed between the time-course for PE-induced FAK and ERK phosphorylation within each experiment. These observations mirror data from numerous studies showing enhanced tyrosine phosphorylation of focal adhesion proteins after integrin ligation induced by plating cells on ECM proteins and are consistent with integrin signaling being a component of PE-induced hypertrophy. Previous studies have shown that tyrosine phosphorylation is central to integrinstimulated focal adhesion formation and downstream signaling. Therefore, we examined the requirement for tyrosine phosphorylation in the induction of PE-induced hypertrophy. Figure 4 shows that the protein tyrosine kinase inhibitors genistein (100µg/ml) or herbimycin A (875 nm) markedly inhibited PE-induced myofibrillar organization and expression of endogenous ANF in cells plated on ECM. However, these inhibitors did not alter viability or morphology of vehicletreated cardiomyocytes (data not shown). These studies corroborate a previous report indicating that induction of an ANF-reporter construct was attenuated by genestein (23). The requirement for tyrosine phosphorylation and the ability of PE to stimulate FAK tyrosine phosphorylation in cardiomyocytes plated on ECM suggested the possibility that FAK is a down-stream mediator of PE stimulated integrin-signaling in the hypertrophy response. To determine whether the integrin signaling required for PE-stimulated hypertrophy is 14
15 dependent on FAK activity, we sought to express a dominant-negative construct corresponding to the C-terminal domain of FAK (termed FRNK) in cardiomyocytes and examine the ability of these cells to undergo PE-mediated hypertrophy. It has been previously shown that FRNK functions to attenuate integrin-mediated tyrosine phosphorylation of FAK and paxillin as well as block integrin-mediated cell spreading and cell migration (12,13). Since this dominant-negative strategy required a high percentage of FRNK-expressing cells in order to observe populational changes in PE-induced signaling, we generated replication-defective adenovirus encoding GFP-tagged FRNK (GFRNK) or GFP alone as a control. GFP and GFRNK were efficiently expressed in % of the cardiomyocyte population as determined by immunofluorescence (data not shown). As shown in Fig 5A, both GFP and GFRNK proteins are expressed in cardiomyocytes within 12 h after adenoviral infection. Importantly, infection of cardiomyocytes with GFP-FRNK but not GFP alone attenuates PE-stimulated FAK activation as assessed by immunoblotting with antibodies specific for FAK ptyr at position 397 (Fig 5B). These data indicate that infection of cardiomyocytes with GFRNK is an effective means of inhibiting FAK signaling in these cells. To determine whether FAK activity was required for PE-stimulated hypertrophy, cardiomyocytes plated on fibronectin were infected with GFP or GFRNK virus prior to PE stimulation. Figure 6 shows that PE stimulates actin rearrangement and ANF-production in GFP-infected cardiomyocytes, indicating that adenovirus alone does not interfere with PEstimulated hypertrophy and is not cytotoxic to these cells. However, infection of cardiomyocytes with GFRNK resulted in a near complete inhibition of PE-stimulated hypertrophy as assessed by cell size, sarcomeric reorganization and endogenous ANF staining (Fig 6). Lack of PE- 15
16 stimulated ANF production in GFRNK infected cells compared to those infected with GFP or uninfected control cells was confirmed by quantitating the amount of ANF secretion in these cells using a peptide enzyme immunoassay. PE stimulated a 3.2±0.9 fold increase in ANF secretion over vehicle treated uninfected control cells (n=5; p<0.05) and a 2.6±0.4 fold increase in GFP-infected cells (n=5, p<0.05). However, no increase (0.94±0.1) in ANF secretion was observed following PE treatment of GFRNK-infected cells (n=5; p>0.05). Basal ANF secretion was not significantly altered by infection with either GFP or GFRNK viruses (n=5, p>0.05). A similar inhibition of PE-stimulated hypertrophy was observed when cells were transfected (rather than infected) with a myc-tagged FRNK cdna construct and scored visually for organized actin structures or ANF production (data not shown). Taken together these data indicate that activation of FAK is critical for maximal PE-stimulated hypertrophy in isolated cardiomyocytes. It is possible that the requirement for functional integrin signaling through FAK in PEstimulated hypertrophy may be due to the ability of FAK to cooperatively activate an essential PE-stimulated pathway. One candidate PE-stimulated pathway involves signaling from Ras to ERK. Activation of ERK2 has been implicated in the regulation of hypertrophic gene expression, and as shown above, PE-stimulated ERK2 activity is dependent on ECM. As shown in Figure 7, PE stimulated a time dependent increase in ERK1/2 activity in GFP-infected cardiomyocytes. However, in cardiomyocytes infected with GFRNK, no increase in ERK1/2 activity was observed following PE treatment. These data indicate that PE-induced signaling to ERK is uncoupled by expression of FRNK and suggest that ERK activation may be a critical point of convergence between FAK and PE signaling. 16
17 DISCUSSION We have shown that PE-induced hypertrophy in isolated neonatal cardiomyocytes requires ECM signaling through FAK. Specifically, plating cells on laminin or fibronectin supports maximal hypertrophic growth, whereas plating on gelatin or type I collagen does not. In addition, in cardiomyocytes plated on laminin or fibronectin, PE enhances the tyrosine phosphorylation of the focal adhesion proteins FAK and CAS and the subsequent formation of focal adhesion complexes. Furthermore, inhibition of signaling through FAK (by ectopic 17
18 expression of a dominant-interfering mutant) attenuates PE-stimulated hypertrophy in isolated cardiomyocytes. The observation that collagen type I is less efficient in supporting PE-induced hypertrophy is consistent with data which demonstrate that neonatal cardiomyocytes have a reduced affinity for type I collagen compared to other ECM such as laminin, fibronectin and type III or IV collagen (6). Our data presented above are also consistent with a recent report showing that PE-mediated ANF production was observed in cardiomyocytes plated on laminin but not in cells plated on the non-adhesive substrate, bovine serum albumin (24). Others, however have reported agonist-induced hypertrophic responses in cardiomyocytes plated on gelatin (25,26). It is possible that the increased cardiomyocyte plating density and the increased duration of the agonist treatment in these latter experiments led to modifications in the ECM environment (e.g., the secretion of ECM proteins) by the myocytes during culture, allowing for the support of hypertrophic growth. The studies described above point to a critical role for integrin signaling and specifically the activation of FAK in cardiomyocyte hypertrophy. Our work confirms and extends that of others indicating that overexpression of the wild type β 1 integrin potentiated PE-induced expression of an ANF reporter gene, whereas ectopic expression of a dominant-interfering integrin mutant attenuated the PE-induced response (24). Interestingly, recent reports have demonstrated that ectoptic expression of wild type or activated Src (F527) stimulate a hypertrophic pattern in neonatal cardiomyocytes (23,27). Src is recruited to activated FAK following integrin ligation and results in the formation of a FAK/Src signaling complex. The apparent requirement for FAK and Src in the hypertrophic response may reflect the need to 18
19 activate signaling pathways downstream of FAK in concert with pathways directly induced by hypertrophic stimuli. A large number of molecules stimulate growth (and hypertrophy) of cardiomyocytes in vitro including a variety of hormones, cytokines and growth factors. Included in the list of mitogens are PE, angiotensin II-, and endothelin I, prostaglandin growth factor 2α and transforming growth factor β among others (5). In regard to signaling, several of these agonists including PE-, angiotensin II- and endothelin I- activate receptors coupled to the heterotrimeric G protein, Gq, and the small molecular weight G protein, Ras. Importantly, the involvement of Gαq and Ras in the hypertrophic response has been shown not only in vitro but also in vivo in several elegant transgenic mouse models (28-30). The signaling molecules downstream of the Gq-coupled receptor responsible for activation of hypertrophy are reasonably delineated and appear to involve signaling through the small molecular weight G protein Ras to the ERK, Jun NH2-terminal kinase (JNK) and p38β MAP kinase pathways (19, 31-34). Our data indicates that activation of ERK1/2 may be a critical point of convergence between integrin- and PE- signaling. We have shown that maximal activation of ERK2 by PE in cardiomyocytes requires FAK-dependent ECM signaling. A similar cooperativity between integrin signaling and growth factor/hormone signaling to ERK2 has been previously observed in other cell types. Indeed, when cultured fibroblasts are held in suspension, PDGF-, EGF- and lysophosphatidic acid-stimulated ERK2 activity is markedly reduced compared to cells plated on fibronectin (14,15). At present, the precise mechanism for the anchorage-dependent activation of ERK2 is not clear. Evidence suggests that activation of the membrane bound receptors and subsequent activation of the small G protein Ras are independent of anchorage 19
20 (14,15). However maximal Ras-mediated activation of the serine/threonine kinase Raf and the downstream kinase MEK requires adhesion signaling (14,15). It is possible that the attenuation of MEK activity observed in suspended cells is due to the absence of integrin-mediated signaling through the Rho family of small GTP binding proteins. Recently it has been shown that members of the Rho family synergize with Raf to activate MEK (35). Importantly, others have shown that the inhibition of ERK2 activation observed in suspended cells can be rescued by over-expression of FAK and our data shows that FRNK attenuates agonist induced ERK1/2 activity in adherent cells (16). Taken together, these data clearly indicate that growth factors (or hormones) synergize with cell adhesion signals to stimulate cell signaling and highlight a possible role for FAK in MAP kinase activation and growth regulation. The precise point of convergence between FAK and PE-signaling to ERK1/2 and other putative downstream signaling molecules that may be important in the development of hypertrophy is currently unclear. A number of signaling molecules including the known FAK binding partners CAS, PI3 kinase, GRB2, paxillin and the Rho-GAP, Graf have been suggested as mediators of FAK signaling (10). We have shown in cardiomyocytes, that PE stimulates a rapid activation of FAK as assessed by enhanced auto-phosphorylation of tyrosine 397 and the subsequent accumulation of phosphotyrosine-rich focal adhesion complexes at the periphery of cells. In addition, PE stimulates tyrosine phosphorylation of two FAK-associated adapter proteins CAS and paxillin in an ECM-dependent fashion. Putative signaling pathways downstream of either CAS or paxillin could involve activation of the ERK, JNK, and p38 MAP kinase pathways, each of which have been implicated in hypertrophic signal transduction (32-34). In certain cell types, association of FAK with CAS is required for integrin-dependent 20
21 ERK2 activation (11). Future experiments will address whether this association is required for PE-stimulated hypertrophy. Interestingly, deletion of CAS by homologous recombination results in embryonic lethality an event likely due in part to abnormal development of the heart (36). Histological examination of hearts from CAS-deficient embryos revealed a thin myocardial wall accompanied by disorganized myofibrils and disrupted Z-disks in the ventricular cardiomyocytes, indicating that CAS may be involved in cardiomyocyte growth and possibly hypertrophy (36). An alternative explanation for the reduced extent of hypertrophy in the absence of FAK signaling is that the cardiomyocytes are undergoing apoptosis. There is a growing body of evidence indicating that the switch from hypertrophy to cardiac failure may involve an apoptotic pathway (34,37,38). For instance, aortic banding of mice with heart-restricted deletion of the gp130 gene results in dilated cardiomyopathy accompanied by cellular apoptosis, an event presumably due to lack of activation of a critical survival signaling pathway during the hypertrophic process (37). Therefore, it is possible that FAK (like gp130) may activate an essential survival pathway that is critical to observe PE-stimulated hypertrophy. Indeed, in other cell types, activation of FAK has been shown to be important for cell survival, and attenuating FAK signaling can lead to apoptosis (39). However, to date we have found no evidence of FRNK-induced apoptosis in cardiomyocytes in our experiments as assessed by DNA content using flow cytometry (unpublished observations). We have shown that PE signaling in cardiomyocytes activates FAK and that activation of FAK is required for PE-stimulated hypertrophy of cultured cells. Since angiotensin II, PGF-α and hypo-osmotic stress also enhance tyrosine phosphorylation of FAK in myocytes, it is 21
22 possible that activation of FAK may be a common requirement for a variety of hypertrophyinducing agents (40-42). The idea that FAK activation may play a role in the development of hypertrophy in vivo is supported by a recent report which demonstrates enhanced cytoskeletal association of β 3 integrin, FAK and Src in pressure overloaded hypertrophying hearts (43). Taken together, these data support a role for integrin-mediated signaling through FAK in the development of cardiac hypertrophy. Future studies will determine the utility of targeting FAK signaling as a potential therapeutic intervention for the treatment of cardiac hypertrophy. ACKNOWLEDGEMENTS This work was supported in part by Grants CA29243 and CA40042 from the DHHS. 22
23 JMT was supported by National Research Award HI-F32-GM18297 and by an American Heart Mid-Atlantic Affiliate Beginning Grant-In-Aid ( U). JDR was supported by a Resident Research Scholarship from the American College of Surgeons. We thank Larry Karns, Allen Everett, and Lou Hammerschold for helpful suggestions. We also thank Wen Xiong and Karen Martin for providing the myc-frnk and GFP-FRNK constructs respectively, Andrew Catling and Michael Weber for providing the ERK reagents, and Stephanie Morton for technical assistance. FIGURE LEGENDS 23
24 Figure 1. PE-stimulated hypertrophy requires ECM. A. Cardiomyocytes were plated on laminin (LAM; 10µg/ml) or gelatin (GEL; 0.1%) in media containing serum for 18 h prior to incubation in the absence of serum for an additional 24 h as described in Experimental Procedures. Following this incubation period, cells were treated with vehicle (top panel) or PE (100 µm; middle and bottom panels). After 30 h, cells were fixed, permeabilized and stained with FITC-phalloidin (left) to visualize sarcomeric reorganization and anti-anf Ab to visualize the induction of ANF (right). B. Cardiomyocytes, plated on 10 µg/ml laminin (LAM), fibronectin (FN), collagen type I (COL), or 0.1% gelatin (GEL), were treated with vehicle or PE as described above. Cells were visually scored for organized sarcomeric structures (left panel) or positive ANF staining (right panel). Data are presented as mean +/- SEM for three separate experiments. For each treatment a total of cells were scored. Figure 2. PE alters subcellular localization of paxillin and phosphotyrosine-containing proteins in isolated cardiomyocytes. Cardiomyocytes were isolated and plated on laminin (10 µg/ml) as described in Experimental Procedures. Cells were treated with PE for 1 or 4 h in serum free media. Cells were fixed, permeabilized and stained with FITC- phalloidin (top panels of A and B), anti-paxillin Ab (bottom panel of A) or anti-phosphotyrosine (PTyr) Ab (bottom panel of B) as described Experimental Procedures. Arrows denote focal adhesion-like complexes at the periphery of cells. Data are representative of three separate experiments. Figure 3. PE stimulates FAK, paxillin, CAS and ERK2 tyrosine phosphorylation in an ECMdependent fashion. Cardiomyocytes were plated on fibronectin (10 µg/ml) in media containing 24
25 10% FCS for 18 h prior to incubation in the absence of serum for an additional 24 h. Following this period, cells were treated with PE (100 µm) for the times indicated. Cells were lysed in RIPA buffer and proteins were separated by SDS-PAGE followed by immunoblotting with a FAK Y397 ptyr Ab (A, top panel). Blots were then stripped and re-probed with an Ab that recognizes total FAK protein (A, bottom panel). CAS (panel B) and paxillin (panel C) were immunoprecipitated from the extracts as described in Experimental Procedures followed by immunoblotting with anti-ptyr Ab (top panels) and the appropriate Ab for loading controls (bottom panels). In panel D, lysates were immunoblotted with a phosphorylation-specific Ab for ERK2 (top panel) and re-probed an Ab that recognizes total ERK1/2 (bottom panel). Data shown are representative of three separate experiments with similar results. Figure 4. Tyrosine kinase inhibitors block PE-stimulated hypertrophy in isolated cardiomyocytes. Cardiomyocytes were isolated and plated on LAM (10 µg/ml) in media containing 10% FCS for 18 h prior to incubation in the absence of serum for an additional 24 h. During this time, cells were pre-treated with vehicle (top panel), Genistein (100 µg/ml for 15 min; middle panels) or Herbimycin A (875 nm for 18 h; bottom panels). Following this incubation period, cells were treated with PE (100 µμ). After 30 h, cells were fixed, permeabilized, and stained with fluorescent phalloidin to visualize actin (left) or and anti-anf Ab (right). Figure 5. Adenoviral-mediated expression of GFP-FRNK attenuates FAK activity in isolated cardiomyocytes. Cardiomyocytes were isolated and plated on FN (10 µg/ml) as described above. 25
26 Cells were infected with GFP or GFP-FRNK (GFRNK) adenovirus (4 MOI) for 12 h. A. Immunoblotting was performed on lysates (50 µg) from GFP infected cells or GFRNK expressing cells using antibodies specific for GFP (left panel) or the C-terminus of FAK (right panel). In panel B, immunoblotting was performed on lysates (100 µg) from uninfected control cells (C), GFP infected cells (GFP) and GFRNK infected cells using a FAK Y397 ptyr Ab (top panel) and an Ab which recognizes total FAK protein (bottom panel). Data are representative of three separate experiments. Figure 6. Adenoviral-mediated expression of GFP-FRNK attenuates PE-stimulated hypertrophy. Cardiomyocytes were isolated, plated on FN (10 µg/ml) and infected with GFP or GFRNK viruses (4 MOI) as described in Experimental Procedures. 12 h post-infection, cells were treated with vehicle (-PE) or 100 µm PE (+PE) for 30 h. Cells were fixed, permeabilized and stained with Texas Red-conjugated phalloidin (panel A) or anti-anf Ab (panel B). GFP and GFRNK expressing cells were visualized by immunofluorescence (left panels). The * in panel A indicates un-infected control cells and the arrow a GFRNK expressing cell. The data presented are representative of four separate experiments. Figure 7. Adenoviral-mediated expression of GFP-FRNK attenuates ERK1/2 kinase activity in isolated cardiomyocytes. Cardiomyocytes were isolated, plated on FN (10 µg/ml) and infected with GFP or GFRNK viruses (4 MOI) as described in Experimental Procedures. 12 h postinfection, cells were treated with 100 µm PE for the times indicated. Cells were lysed in RIPA buffer and ERK1/2 was immunoprecipitated from the extracts. ERK immunoprecipitates were 26
27 incubated with 2 µg of myelin basic protein (MBP) and [γ 32 P]ATP as described in Experimental Procedures. Samples were analyzed by SDS-PAGE, and the gel was transferred to nitrocellulose and exposed to Kodak XAR film for 1 h (top). The membrane was then probed with anti-erk1/2 Ab for a loading control (bottom). Data shown are representative of five separate experiments with similar results. 27
28 REFERENCES 1. Komuro, I. and Yazaki, Y. (1993) Annu Rev Physiol 55, Chrzanowska-Wodnicka, M. and Burridge, K. (1996) J. Cell Biol. 133(6), Hynes, R. O. (1992) Cell 69, Graf, K., Do, Y. S., Ashizawa, N., Meehan, W. P., Giachelli, C. M., Marboe, C. C., Fleck, E., and Hsueh, W. A. (1997) Circulation 96, Mamuya, W., Chobanian, A., and Brecher, P. (1992) Circ Res 71, Terracio, L., Rubin, K., Gullberg, D., Balog, E., Carver, W., Jyring, R., and Borg, T. K. (1991) Circ Res 68, McDonald, J. A. and Valencik, M. (1998) Keystone Symposium X7, A220(Abstract) 8. Schaller, M. D., Hildebrand, J. D., Shannon, J. D., Fox, J. W., Vines, R. R., and Parsons, J. T. (1994) Mol Cell Biol 14, Jockusch, B. M., Bubeck, P., Giehl, K., Kroemker, M., Moschner, J., Rothkegel, M., Rudiger, M., Schluter, K., Stanke, G., and Winkler, J. (1995) Ann Rev Cell Dev Biol 11, Parsons J.T. (1996) Curr. Opin. Cell Biol. 8, Schlaepfer, D. D. and Hunter, T. (1997) J. Biol. Chem. 272, Richardson, A., Malik, R. K., Hildebrand, J. D., and Parsons, J. T. (1997) Mol Cell Biol 17, Richardson, A. and Parsons, T. (1996) Nature 380, Renshaw, M. W., Ren, X. D., and Schwartz, M. A. (1997) EMBO J 16,
29 15. Lin TH, Chen Q, Howe A, and Juliano RL. (1997) J. Biol Chem 272, Renshaw MW, Price LS and Schwartz MA. (1999) J. Cell Biol. In Press. 17. Bouton, A. H. and Burnham, M. R. (1997) Hybridoma 16, Hardy S, Kitamura M, Harris-Stansil T, Dai Y, and Phipps ML (1997) J. Virology 71, Thorburn J, McMahon M, and Thorburn A. (1994) J. Biol. Chem 269, Simpson PC, McGrath A, and Savion S. (1982) Circ. Res. 51, Sadoshima, J. and Izumo, S. (1997) Annu Rev Physiol 59, Chien, K. R., Zhu, H., Knowlton, K. U., Miller-Hance, W., van-bilsen, M., O Brien, T. X., and Evans, S. M. (1993) Annu Rev Physiol 55, Fuller, S. J., Gillespie-Brown, J., and Sugden, P. H. (1998) J. Biol. Chem. 273, Ross, R. S., Pham, C., Shai, S. Y., Goldhaber, J. I., Fenczik, C., Glembotski, C. C., Ginsberg, M. H., and Loftus, J. C. (1998) Circ Res 82, Hoshijima, M., Sah, V. P., Wang, Y., Chien, K. R., and Brown, J. H. (1998) J Biol Chem 273, Sah, V. P., Hoshijima, M., Chien, K. R., and Brown, J. H. (1996) J. Biol. Chem. 271, Kovacic, B., Ilic, D., Damsky, C. H., and Gardner, D. G. (1998) J. Biol. Chem. 273, Akhter SA, Luttrell LM, Rockman HA, Iaccarino G, Lefkowitz RJ, and Koch WJ. (1998) Science 280,
30 29. Thorburn A, Thorburn J, Chen S-Y, Powers S, Shubeita HE, Feramisco JR, and Chien KR. (1993) J. Biol. Chem. 268, Hunter JJ, Tanaka N, Rockman HA, Ross J, and Chien KR. (1995) J. Biol. Chem. 270, Zechner D, Thuerauf DJ, Hanford DS, McDonough PM, and Glembotski CC. (1997) J. Cell Biol. 139, Ramirez, M. T., Sah, V. P., Zhao, X. L., Hunter, J. J., Chien, K. R., and Brown, J. H. (1997) J Biol Chem 272, Wang, Y., Su, B., Sah, V. P., Brown, J. H., Han, J., and Chien, K. R. (1998) J Biol Chem 273, Wang, Y., Huang, S., Sah, V. P., Ross, J.,Jr., Brown, J. H., Han, J., and Chien, K. R. (1998) J Biol Chem 273, Frost JA, Steen H, Shapiro P, Lewis T, Ahn N, Shaw PE, and Cobb MH (1997) EMBO 16, Honda, H., Oda, H., Nakamoto, T., Honda, Z., Sakai, R., Suzuki, T., Saito, T., Nakamura, K., Nakao, K., Ishikawa, T., Katsuki, M., Yazaki, Y., and Hirai, H. (1998) Nat Genet 19, Hirota H, Chen J, Betz UAK, Rajewsky K, Gu Y, Ross J JR, Muller W and Chen K. (1999) Cell 97, Adams, JW, Sakata Y, Davis MG, Sah VP, Wang Y, Liggett SB, Chien KR, Brown JH, Dorn GW II. (1998) PNAS 95, Ilic D, Almeida EA, Schlaepfer DD, Aizawa S, Damsky CH. (1998) J. Cell Biol. 143,
31 40. Adams, J. W., Sah, V. P., Henderson, S. A., and Brown, J. H. (1998) Circ Res 83, Sadoshima, J., Qiu, Z., Morgan, J. P., and Izumo, S. (1996) EMBO J 15, Polte, T. R., Naftilan, A. J., and Hanks, S. K. (1994) J. Cell. Biochem. 55, Kuppuswamy, D., Kerr, C., Narishige, T., Kasi, V. S., Menick, D. R., and Cooper, G. (1997) J Biol Chem 272,
32 A. E GEL + PE LAM + PE LAM ACTIN ANF Taylor et. al. FIG 1A
33 B. ACTIN ORGANIZATION ANF PRODUCTION C PE C PE % TOTAL CELLS % TOTAL CELLS LAM FN COL GEL 0 LAM FN COL GEL Taylor et. al. FIG 1B
34 A. ACTIN PAXILLIN Time (hr) Taylor et. al. FIG 2A
35 B. ACTIN PTYR Time (hr) Taylor et. al. FIG 2B
36 Taylor et. al. FIG 3 A. IB:FAKpY GEL FN FAK IB:FAK FAK PE (100 µm) Time (min) B. FN C. FN IP:CAS IB:PTyr CAS IP:Pax IB:PTyr Pax IP:CAS IB:CAS CAS IP:Pax IB:Pax Pax 0 15 Time (min) 0 15 Time (min) PE (100 µm) PE (100 µm) D. GEL FN IB:ERKpY ERK2 IB:ERK ERK PE (100 µm) Time (min)
37 PE + HERB PE + GEN PE ACTIN ANF Taylor et. al. FIG 4
38 Taylor et. al. FIG 5 A. IB:GFP IB:FAK FAK GFRNK GFP GFRNK GFP GFRNK GFP B. IB:FAKpY FAK IB:FAK FAK C GFP GFRNK
39 A. Fluorescence Actin GFRNK + PE GFP + PE GFRNK - PE GFP - PE * * * * Taylor et. al. FIG 6A
40 B. Fluorescence ANF GFRNK + PE GFP + PE Taylor et. al. FIG 6B
41 Taylor et. al. FIG 7 GFP GFRNK IP:ERK 32 P-MBP MBP IP:ERK IB:ERK ERK Time (min)
Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
MEK1/2 (MAPK Kinase) Activity Assay Kit
MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)
Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis
icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,
Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated
Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: Volume: 44-625G (10 mini-blot size) See product label 100 μl Clone Number:
ab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
ab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Lab Module 7: Cell Adhesion
Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix
TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
MitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Immunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
SUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
This Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
Rabbit (polyclonal) Anti-Rac1/cdc42 [ps 71 ] Phosphospecific Antibody, Unconjugated
Rabbit (polyclonal) Anti-Rac1/cdc42 [ps 71 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: 0101 Volume: 100 µl (10 mini-blot size) Form of Antibody: Rabbit polyclonal
1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:
Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)
SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin
For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
Electrophoresis and transfer
Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have
Application Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
ab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
RayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
Rat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
TECHNICAL BULLETIN. JNK 1&2 Activity Assay Kit. Product Number CS0380 Storage Temperature 20 C
JNK 1&2 Activity Assay Kit Product Number CS0380 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The c-jun N-terminal kinases (JNKs), also known as stress activated protein kinases (SAPKs),
FRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Ral Activation Assay Kit
Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of
SUMOylated protein capture kit
SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided
7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
QuickTiter Adenovirus Titer ELISA Kit
Product Manual QuickTiter Adenovirus Titer ELISA Kit Catalog Number VPK-110 2 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Recombinant adenoviruses have tremendous
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
In Vitro Angiogenesis Assay Kit
In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
ab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).
Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and
Radius 24-Well Cell Migration Assay (Fibronectin Coated)
Product Manual Radius 24-Well Cell Migration Assay (Fibronectin Coated) Catalog Number CBA-125-FN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly
Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
Table of Contents. I. Description...2. II. Components and Storage...2. III. Reagents and Instruments Required but not Supplied in the Kit...
Table of Contents I. Description...2 II. Components and Storage...2 III. Reagents and Instruments Required but not Supplied in the Kit...4 IV. Gene Transduction...4 V. Transduction Protocol...5 A. RetroNectin
HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications
PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion
Azure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
Strep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
SDS-PAGE and Western Blot. Molecular Basis of Evolution
1 SDS-PAGE and Western Blot Molecular Basis of Evolution Homology high level of DNA and protein sequence similarity due to common ancestry. Evidence Genomes of related organisms are very similar. Even
In-Cell Western Assay
In-Cell Western Assay Complete Sample Protocol for Measuring IC 50 of Inhibitor U0126 in NIH3T3 Responding to Acidic Fibroblast Growth Factor (afgf-1) Developed for: Aerius, Odyssey Classic, Odyssey CLx,
7.06 Problem Set #3, Spring 2005
7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a
PhosphoTracer STAT3 Total ELISA Kit
ab119651 PhosphoTracer STAT3 Total ELISA Kit Instructions for Use For the semi-quantitative measurement of STAT3 Total concentrations in cell culture extracts This product is for research use only and
MICB688L/MOCB639 Advanced Cell Biology Exam II
MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please
EdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
EGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
96-well Checkpoint Kinase Activity Assay Kit
Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a
CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
Required role of focal adhesion kinase (FAK) for integrin-stimulated cell migration
Journal of Cell Science 112, 2677-2691 (1999) Printed in Great Britain The Company of Biologists Limited 1999 JCS0499 2677 Required role of focal adhesion kinase (FAK) for integrin-stimulated cell migration
SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *
Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]
Xfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
special offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent
APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,
WesternBright Quantum
User Manual WesternBright Quantum Chemiluminescent HRP Substrate For Catalog Numbers K-12042-C20 20 ml, sufficient for 200 cm 2 K-12042-D10 100 ml, sufficient for 1000 cm 2 K-12042-D20 200 ml, sufficient
ApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
How to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
Generic DELFIA Reagents
AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody
ab Complex I Enzyme Activity Microplate Assay Kit
ab109721 Complex I Enzyme Activity Microplate Assay Kit Instructions for Use For the analysis of Complex I enzyme activity from Human, Rat, Mouse and Bovine samples This product is for research use only
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
His- Tag Protein ELISA Kit
Revised Protocol Product Manual His- Tag Protein ELISA Kit Catalog Numbers AKR- 130 96 wells FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction A polyhistidine-tag, or His-tag, is
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
Automated Imaging Assay for Characterizing Ca 2+ Flux with R-GECO Biosensor
A p p l i c a t i o n N o t e Automated Imaging Assay for Characterizing Ca 2+ Flux with R-GECO Biosensor Joe Clayton, Ph.D., and Peter Banks, Ph.D., BioTek Instruments, Inc., Winooski, VT USA Abstract
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
Supporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
Serine Phosphorylation of Focal Adhesion Kinase in Interphase and Mitosis: A Possible Role in Modulating Binding to p130 Cas
Molecular Biology of the Cell Vol. 12, 1-12, January 2001 Serine Phosphorylation of Focal Adhesion Kinase in Interphase and Mitosis: A Possible Role in Modulating Binding to p130 Cas Amy Ma,* Alan Richardson,*
For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.
DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF
Radiance. Long Protocol for Catalog Numbers. Chemiluminescent substrate for quantitative chemiluminescent Westerns
Radiance Chemiluminescent substrate for quantitative chemiluminescent Westerns Long Protocol for Catalog Numbers AC2100 Radiance Sample, sufficient for 140 cm 2 membrane AC2101 Radiance, 150 ml, sufficient
Tyrosine Kinase Assay Kit
Instruction Manual for Tyrosine Kinase Assay Kit Colorimetric Detection Catalog # 17-315 Direct ELISA system for the colorimetric detection of protein tyrosine phosphotransferase activity using a biotinylated
JBC Papers in Press. Published on July 31, 2002 as Manuscript M
JBC Papers in Press. Published on July 31, 2002 as Manuscript M205899200 Association of the Ste20-like Kinase SLK with the Microtubule: Role in Rac1-Mediated Regulation of Actin Dynamics during Cell Adhesion
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Cdc42 Activation Assay Kit
Product Manual Cdc42 Activation Assay Kit Catalog Number STA- 402 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family