Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
|
|
- Arnold Doyle
- 6 years ago
- Views:
Transcription
1 Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland
2 Introduction Nicotiana sylvestris and Nicotiana tomentosiformis are diploids (2n=12) originating from overlapping regions of South America They probably diverged early in the evolution of genus Nicotiana which split from Symonanthus around 15 Myr ago 1 Their 1C genome size is estimated at 2.65 Gb 1, about 3 times the size of the tomato and the potato genomes 1. Renny-Byfield, S. et al Next Generation Sequencing Reveals Genome Downsizing in Allotetraploid Nicotiana tabacum, Predominantly through the Elimination of Paternally Derived Repetitive DNAs. Mol. Biol. Evol. 28:2843. Page: 2
3 Introduction Modern descendants of the maternal and paternal donors that formed tobacco 1 N. sylvestris ancestor 2n=24 N. tomentosiformis ancestor 2n=24 The determination of their genome and transcriptome will contribute to the assembly and annotation of the tobacco genome and transcriptome N. tabacum 2n=4x=48 1. Leitch, I.J. et al The ups and downs of genome size evolution in polyploid species of Nicotiana (Solanaceae). Ann Bot Apr;101(6): Page: 3
4 Genomes sequencing and assembly strategy DNA isolation - Leaves Library preparation - Paired ends - Mate pairs Sequencing Illumina 2x100 bp Quality filtering and trimming Superscaffolding Scaffolding - SOAPdenovo Contig creation - SOAPdenovo related species Tobacco WGP physical map Page: 4
5 Genome libraries Nicotiana sylvestris Total coverage of 94x Library type Read size Insert size Cleaned reads Expected coverage Paired ends 2x b x Paired ends 2x b x Paired ends 2x100 1 kb x Mate pairs 2x100 3 kb x Mate pairs 2x100 4 kb x Mate pairs 2x100 4 kb x Using the 31-nucleotide depth distribution, the genome size is estimated at 2.58 Gb. Page: 5
6 Genome libraries Nicotiana tomentosiformis Total coverage of 146x Library type Read size Insert size Cleaned reads Expected coverage Paired ends 2x b x Paired ends 2x b x Paired ends 2x b x Paired ends 2x b x Paired ends 2x100 1 kb x Mate pairs 2x100 3 kb x Mate pairs 2x100 5 kb x Using the 31-nucleotide depth distribution, the genome size is estimated at 2.14 Gb. Page: 6
7 Genome assemblies N. sylvestris N. tomentosiformis Sequences Average length (bp) Maximum length (bp) N50 length (bp) Total length (bp) Undefined bases (7.8%) (2.7%) Genome coverage 82.9% 71.6% Using the S/T regions of the tobacco WGP physical map N. sylvestris N. tomentosiformis Superscaffolds Components N50 length (bp) Page: 7
8 Repeat content Species specific repeat library created using RepeatScout on sequences of at least 200kb. Repeat classification using blast against known repeat elements. Repeat content estimation using RepeatMasker with the RepeatScout, TIGR Solanaceae and SOL eudicot repeat libraries. Page: 8
9 Repeat contents 72-75% of the sequenced genome consists of repeats. 625 and 425 Mb of unmasked DNA for N. sylvestris and N. tomentosiformis. Repeat element N. sylvestris N. tomentosiformis LINE (0.3%) (0.2%) SINE (0.2%) (0.3%) LTR/Copia (9%) (13%) LTR/Gypsy (21%) (20%) LTR/Others (8%) (5%) Transposons (1.5%) (1%) Retrotransposons (10%) (13%) Simple repeats (0.2%) (0.3%) Low complexity (0.5%) (0.6%) Others (13%) (15%) Total (72%) (75%) Page: 9
10 Transcriptome sequencing and assembly strategy RNA isolation - Leaves - Roots -Flowers Library preparation - Paired ends Sequencing Illumina 2x100 bp 3 biological replicates Quality filtering and trimming ORF finding Isoform prediction - cufflinks/cuffmerge Annotation Read mapping - bowtie/tophat - BLAST - InterPro Scan (GO terms) - EFICAz (EC number) Page: 10
11 Transcriptome assemblies Nicotiana sylvestris Tissue Transcripts Shortest Longest Median Roots Leaves Flowers Nicotiana tomentosiformis Tissue Transcripts Shortest Longest Median Roots Leaves Flowers Page: 11
12 Mutual best BLAST hits against UniProt Proteins predicted by Trinity ORF finding program Minimum length of 100 amino acids Mutual blast against UniProt plants collection Filter pairs by e-value of less than 1E-10 in either direction Select proteins with mutual best hits Best blast hit Best blast hit Predicted protein UniProt protein Predicted protein Best blast hit Page: 12
13 Mutual best blast hits against UniProt N. sylvestris N. tomentosiformis Coverage of reference Coverage of query 82% of the transcripts have homologous UniProt sequences, but some of them are only partially covering the reference sequence. Page: 13
14 GO term enrichment GO term enrichment for each species against the pooled set of GO terms using GOStats. Only small and not highly significant changes in gene composition. N. sylvestris: defense response function N. tomentosiformis: core metabolic functions, protein phosphorylation Phenotypic difference more likely to be regulatory than due to loss or gain of genes. Page: 14
15 Transcriptome overlap OrthoMCL was used to define clusters of orthologous and paralogous genes between species: N. sylvestris N. tomentosifomis Tomato Arabidopsis And between the root, leaf and flower transcriptomes of N. sylvestris and N. tomentosifomis. Page: 15
16 Transcriptome overlap between species ~7 000 clusters are shared between all species. ~3 600 clusters are specific to Nicotiana. ~2 800 clusters are specific to Solanaceae. Page: 16
17 Transcriptome overlap in N. sylvestris ~ clusters are shared. ~3 500 clusters are specific to flower. ~2 000 clusters are specific to root. ~1 800 clusters are specific to leaf. Page: 17
18 Transcriptome overlap in N. tomentosiformis ~ clusters are shared. ~3 400 clusters are specific to flower. ~2 600 clusters are specific to root. ~1 900 clusters are specific to leaf. Page: 18
19 Conclusions Nicotiana sylvestris and Nicotiana tomentosiformis have been sequenced at a coverage of about 100x and 150x respectively. 83% of the N. sylvestris genome covered. 72% of the N. tomentosiformis genome covered. the tobacco WGP physical map can be used to superscaffold the assembly. Between and transcripts are identified by mapping of RNA-seq data. More than 80% have homologs in UniProt. Page: 19
20 Conclusions About clusters of orthologous and paralogous genes genes are shared between root, leaf and flower clusters specific to flowers About clusters of orthologous and paralogous genes are shared between N. sylvestris, N. tomentosiformis, tomato and Arabidopsis. About clusters of orthologous and paralogous genes specific to Nicotiana species. The obtained genomes and transcriptomes will contribute to the assembly and annotation of the tobacco genome. Page: 20
21 Acknowledgments James Battey Sonia Ouadi Lucien Bovet Simon Goepfert Nicolas Bakaher Manuel C. Peitsch Nikolai V. Ivanov Page: 21
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
More informationSupplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationConsensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
More informationRNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationGenome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
More informationBiol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationThe genome of Fraxinus excelsior (European Ash)
The genome of Fraxinus excelsior (European Ash) Elizabeth Sollars, Laura Kelly, Bernardo Clavijo, David Swarbreck, Jasmin Zohren, David Boshier, Jo Clark, Anika Joecker, Sarah Ayling, Mario Caccamo, Richard
More informationWheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
More informationAssessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationExploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationHigh quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More informationSupplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line Table of Contents SUPPLEMENTARY TEXT:... 2 FILTERING OF RAW READS PRIOR TO ASSEMBLY:... 2 COMPARATIVE ANALYSIS... 2 IMMUNOGENIC
More informationPost-assembly Data Analysis
Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis
More informationDe novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More informationSteps in Genetic Analysis
Molecular Tools Steps in Genetic Analysis 1. Knowing how many genes determine a phenotype, and where the genes are located, is a first step in understanding the genetic basis of a phenotype 2. A second
More informationRNA standards v May
Standards, Guidelines and Best Practices for RNA-Seq: 2010/2011 I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable properties for quantification,
More informationSequencing and assembly of the sheep genome reference sequence
Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming
More informationGene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton
Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationYellow-bellied marmot genome. Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA
Yellow-bellied marmot genome Gabriela Pinho Graduate Student Blumstein & Wayne Labs EEB - UCLA Why do we need an annotated genome?.. Daniel T. Blumstein Kenneth B. Armitage 1962 2002 Samples & measurements
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationUsing the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!
Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! buell@msu.edu! 1 Whole Genome Shotgun Sequencing 2 New Technologies Revolutionize
More informationWhat the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt
What the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt Laurel Wilt Summit November 3-4, 2016 Dr. Jeffrey Rollins Associate Professor Plant Pathology Department University of Florida Gainesville,
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationIdentifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
More informationGenome evolution on the allotetraploid Xenopus laevis
Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics
More informationBIO 4342 Lecture on Repeats
BIO 4342 Lecture on Repeats Jeremy Buhler June 14, 2006 1 How RepeatMasker Works Running RepeatMasker is the most common first step in annotating genomic DNA sequences. What exactly does it do? Given a
More informationCOMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
More informationCBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
More informationApplied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationAssemblathon Summary Report
Assemblathon Summary Report An overview of UC Davis results from Assemblathon 1: 2010/2011 Written by Keith Bradnam with results, analysis, and other contributions from Ian Korf, Joseph Fass, Aaron Darling,
More informationProgress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses Dr. Susanne Barth Teagasc Crops Research Centre Oak Park Carlow Irland Global challenges
More informationDE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationThe international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
More informationI AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador
I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationAnker P Sørensen Crop innovation through novel NGS applications
nker P Sørensen Crop innovation through novel NGS applications Session 1: NGS / Omic Technologies for Plant Research 19 e March 2015, Kuala Lumpur Malaysia KeyGene s corporate profile Wageningen NL Rockville
More informationNGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationThe use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015
The use of bioinformatic analysis in support of HGT from plants to microorganisms Meeting with applicants Parma, 26 November 2015 WHY WE NEED TO CONSIDER HGT IN GM PLANT RA Directive 2001/18/EC As general
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationWhole Genome Profiling Physical Map and. Ancestral Annotation of Tobacco Hicks Broadleaf
Received Date : 30-Jan-2013 Revised Date : 22-Apr-2013 Accepted Date : 09-May-2013 Article type : Resource Whole Genome Profiling Physical Map and Ancestral Annotation of Tobacco Hicks Broadleaf Nicolas
More informationWhole Genome Profiling Physical Map and. Ancestral Annotation of Tobacco Hicks Broadleaf
Received Date : 30-Jan-2013 Revised Date : 22-Apr-2013 Accepted Date : 09-May-2013 Article type : Resource Whole Genome Profiling Physical Map and Ancestral Annotation of Tobacco Hicks Broadleaf Nicolas
More informationShuji Shigenobu. April 3, 2013 Illumina Webinar Series
Shuji Shigenobu April 3, 2013 Illumina Webinar Series RNA-seq RNA-seq is a revolutionary tool for transcriptomics using deepsequencing technologies. genome HiSeq2000@NIBB (Wang 2009 with modifications)
More informationThe tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationFinding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
More informationHow much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
More informationTranscription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
More informationRapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
More informationDe novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationTechnologies, resources and tools for the exploitation of the sheep and goat genomes.
Technologies, resources and tools for the exploitation of the sheep and goat genomes. B. P. Dalrymple, G. Tosser-Klopp, N. Cockett, A. Archibald, W. Zhang and J. Kijas. The plan The current state of the
More informationFigure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
More informationNGS the subterranean realm: from RNA-seq to bait design for a groundwater isopod Danielle Stringer
NGS the subterranean realm: from RNA-seq to bait design for a groundwater isopod Danielle Stringer Michelle Guzik, Karen Meusemann, Simon Tierney, Rachael King, Steve Cooper and Andy Austin Aridification
More informationDe Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
More informationA tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp
More informationDE NOVO GENOME ASSEMBLY OF THE AFRICAN CATFISH (CLARIAS GARIEPINUS)
DE NOVO GENOME ASSEMBLY OF THE AFRICAN CATFISH (CLARIAS GARIEPINUS) Kovács B. a,, Barta E. c, Pongor S. L. b, Uri Cs. a, Patócs A. b, Orbán L. d, Müller T. a, Urbányi B. a a Department of Aquaculture,
More informationGenome Annotation. Stefan Prost 1. May 27th, States of America. Genome Annotation
Genome Annotation Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America May 27th, 2015 Outline Genome Annotation 1 Repeat Annotation 2 Repeat
More informationA draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationAn Extreme Metabolism: Iso-Seq analysis of the Ruby-Throated Hummingbird
An Extreme Metabolism: Iso-Seq analysis of the Ruby-Throated Hummingbird Rachael Workman 1, Kenneth Welch 2, G. William Wong 3, Winston Timp 1 1 Department of Biomedical Engineering, Johns Hopkins University
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationTECH NOTE Stranded NGS libraries from FFPE samples
TECH NOTE Stranded NGS libraries from FFPE samples Robust performance with extremely degraded FFPE RNA (DV 200 >25%) Consistent library quality across a range of input amounts (5 ng 50 ng) Compatibility
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationA Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al.
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al. Supplementary Notes Origin of NMR19 elements Because there are two copies
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationPerfect~ Arthropod Genes Constructed from Gigabases of RNA
Perfect~ Arthropod Genes Constructed from Gigabases of RNA Don Gilbert Biology Dept., Indiana University gilbertd@indiana.edu May/June 2012 Perfect Arthropod Genes Gen 2 genome informatics Gene prediction
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationAnalysis of structural variation. Alistair Ward - Boston College
Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an
More informationAlignment to a database. November 3, 2016
Alignment to a database November 3, 2016 How do you create a database? 1982 GenBank (at LANL, 2000 sequences) 1988 A way to search GenBank (FASTA) Genome Project 1982 GenBank (at LANL, 2000 sequences)
More informationDraft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
More informationHigh throughput sequencing technologies
High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger
More information