This is a typical chromatogram generated by automated sequencing.

Transcription

1 DNA TECHNOLOGY AND FORENSICS Introduction: DNA (Deoxyribonucleic Acid) is a molecule that is the main part of your chromosomes, which carry your hereditary material. The molecule is shaped like a twisted ladder: the outside of the ladder is made up of alternating phosphate and sugar molecules. The steps of the ladder are made up of bases. There are four types of bases: Adenine (A), Thymine (T), Guanine (G), Cytosine (C) In making the steps of the DNA ladder, the bases pair up a particular way: A pairs with T; G pairs with C Therefore, DNA is really made up of 2 strands, one strand has its own base sequence, and the other strand has a complementary base sequence. ATGCGTAATGC... strand TACGCATTACG... complementary strand Every organism has their own DNA sequence in their chromosomes. When we say DNA sequence, we are referring to one of the strands (like the top strand). Let's compare the sequence of the gene that codes for eye color... The DNA sequence for brown eyes would be slightly different from the sequence for blue eyes. brown eyes sequence: AAAAGCGCCCGGG... blue eyes sequence: AAATGCGCCCGCG... The letters that are in bold are the bases that are different between the two sequences. Genes in general are about 1000 bases long. Therefore, you will see variation in the sequences from individual to individual. The general rule of thumb is that individuals that are the same species will have DNA sequence that is very similar. The DNA sequence of organisms from different species (example: cat vs. snake) would be very different. Remember, genes code for the makeup of an organism. The more different an organism looks from another, the more different their DNA sequence would be as well. Scientists today have determined thousands of DNA sequences, of hundreds of genes and of hundreds of organisms. Currently many researchers are involved in determining the entire DNA sequence of one individual. Sequence knowledge will allow us to identify certain genes that can cause medical problems (genetic defects). Scientists would then be able to treat patients accordingly. Forensics Since people have their own unique DNA sequence, we can identify persons responsible for crimes such as murder and rape as well as determining paternity. DNA sequences are frequently preserved well enough in hair, semen or bloodstains, even if it is in dried form. The extracted DNA is then compared with those of a victim or suspect. One way to identify a suspect is by performing the molecular technique called DNA Sequencing. This is done two ways: either by tagging the 4 types of bases with 4 different color dyes or with radioactive chemicals. The first method (using dyes) is called Automated Sequencing because it is mostly all computerized. It is safer to use and it only takes 36 hours to get results. The results come in both text and graphical form. Because this method is relatively quick, it is more commonly used today. However, it requires a laser beam to read the tagged bases, and the machine costs about $130,000. This is a typical chromatogram generated by automated sequencing.

2 The other technique is called the Sanger method (named after the man who invented the technique). It requires radioactive sulfur to tag the bases. Using radioactively requires more safety precautions and is much more time consuming, taking 5-8 days to get results. Plus you have to manually read the results off of an "X-ray" picture (called an autorad). However, it is far less costly to get results.

3

4 RFLP-DNA Fingerprinting There are other molecular techniques used today which are still low in cost, and are not as time consuming: called DNA fingerprinting. A large portion of mammalian DNA consists of tandemly arranged repeats called satellites, which are nucleotide sequences that are repeated hundreds of times and are located between genes. These satellite regions have no known function, but they are genetically determined and vary in the number of repeats from individual to individual. A DNA fingerprint of these regions can then be compared among individuals in a case. The following procedure describes the DNA fingerprinting process. Once DNA is extracted from where it was found, the DNA is cut into pieces using an enzyme that specifically breaks DNA strands at specific regions. After making all different size pieces of DNA (called restriction fragments), we can then separate the pieces by size and get a pattern. This pattern is called the DNA fingerprint.

5 The enzymes used to cut DNA are called restriction enzymes. They get their name from the fact that each enzyme can only cut the DNA where it recognizes a small sequence. For example: one restriction enzyme only recognizes the sequence: CCGG and will only cut between the C and G...CC / GG... So, every time that sequence appears on the DNA strand, it will be cut there. ACTTTCC / GGATCTAGGCATCC / GGCAAATTAGC TGAAAGG / CCTAGATCCGTAGG / CCGTTTAATCG Once you cut the DNA into pieces, you need to separate the pieces so you can view them. DNA is negatively charged. If we put the DNA in an electric field (positive electrode at one end, negative electrode at the other end), the DNA will move towards the positive electrode. This technique is called gel electrophoresis.

6 Note: If we cut all of the DNA in a cell with a restriction enzyme, we would end up with hundreds of bands - which would appear as a smear on the gel. Since there is a relatively large amount of satellite DNA, those bands would appear darker than the rest of the genome. Another molecular technique is used to target just the satellite DNA, called Southern Blotting. This technique uses small radioactive probes (20 nucleotides long) that complement a portion of the satellite

7 sequence and tag it. An X-ray picture is then taken to view the DNA fingerprint. This way you end up with a small number of fragments that you can see as distinct separate bands on the gel. DNA Fingerprinting Reveals Genetic Relationships among Different Organisms Notice the DNA fingerprints of the 2 cats have almost all of the bands in common. The mountain lion, which is also a feline, has many bands (but not as many) in common as well. The dogs together have similar bands, but both are very different from the cats. Since people have their own unique DNA sequence, we can identify persons responsible for crimes such as murder and rape, as well as determining paternity. DNA sequences are frequently preserved well enough in hair, semen, and dried bloodstains. Here is an example of DNA fingerprints used in paternity suit. The more closely related a person is to another, the greater number of identical bands will be shared. This gel image indicates that putative father #2 was the father of the child. The child contains bands unique to his mother and unique to father #2. lane 1 = mother 2 = child 3 = putative father #1 4 = putative father #2

8 Suppose we had two suspects for the same crime. We take a blood sample from each person, and cut each of their DNA with the same kind of restriction enzyme. We can then run their DNA side-by-side in the same gel along with the DNA taken from the crime scene. We then look to see if their DNA fingerprints are the same as the fingerprint of the blood from the crime scene. Any differences in patterns between individuals are called RFLPs (restriction fragment length polymorphisms). The more bands (DNA fragments) that are in common with the crime scene DNA, the more likely they have found their suspect. The whole process can take only a couple of days.

9 There are 5 Different Paternity Cases Below. Is "He" the Father in each Case?

10 PCR (Polymerase Chain Reaction) RFLP requires a fairly large amount of DNA for testing. However, suppose there is only one drop of blood at a crime scene. A technique called PCR (polymerase chain reaction) is used to generate millions of copies of DNA in vitro. Although only invented a decade ago, this process is the most popular technique used in molecular labs today. You only need 10 nanograms of DNA (that is 10-9 grams) and it only takes 5 hours to generate enough DNA for fingerprinting. The process of PCR is very similar to the process of DNA replication in the cell, except that it makes DNA in a tiny test tube. Within your tube you have the DNA sample, all of the chemicals to make new strands of DNA (the four types of nucleotides, A, G, C, T, buffer, a DNA polymerase

11 enzyme and a primer. The primer is a short piece of DNA that is made synthetically in a machine. (Yes... we can make our own DNA!!) One example of a primer is: GATCCCCTAGCCGGTAGCGG This primer is only 20 bases long and ends up base pairing with the DNA that has complementary sequence like: CTAGGGGATCGGCCATCGCC. These areas will be the starting point for making new DNA strands. Primers are designed to complement the beginning and the end of the portion of the DNA that you want to make millions of copies. For example, they can be flanking the satellite regions. During PCR, the 2 DNA strands are separated by heat (93C), then the temperature goes down to about 50C. At that point, the primers stick to the DNA at all of the complementary sites. The primers will stick to places on BOTH strands, too. Then the temperature is brought up to 72C. At this time new nucleotides (bases) are put on right next to the primers, one at a time, complementing the strand opposite it. Then the cycle repeats. After one of these cycles, one copy of DNA is made into 2 copies. After 2 cycles, 4 copies of DNA are made... then 8... then and so on. After 40 cycles, you'll end up with over 1 million copies of DNA. This is called DNA amplification because you are amplifying the amount of DNA that you had originally. Once the amplified DNA is generated, then you can digest the fragment with different restriction enzymes to generate different DNA fingerprints. This procedure is quicker and less costly than DNA sequencing. Another advantage is that you can screen several satellite regions (they can be located on different chromosomes) using this PCR-RFLP technique. With DNA sequencing, you are only viewing a small portion of the genome. The diagram below illustrates the PCR reaction:

12 National Fish and Wildlife Laboratory

13 This type of forensics lab was created for the purpose of providing forensic support to wildlife law enforcement officers. The mission of the forensics lab is to: 1) identify the animal species from parts or products of animals. 2) determine the cause of death of the animal 3) help determine if a violation of law has occurred 4) identify and compare physical evidence in an attempt to link suspect, victim, and crime scene The only real difference between the wildlife lab and a police crime lab is that the victim is an animal. Every now and then the suspect can turn out to be another animal (besides a person). They try not to confuse the natural events of natural (predator/prey) interactions with human violations of wildlife law. Evidence can be: blood, tissue, whole carcasses, bones, teeth, claws, talons, tusks, hair, hides, furs, feathers, leather goods (purses, boots...), poisons, pesticides, stomach contents, weapons, sleeping medicines, and more. Identifying the DNA of wildlife parts and products is far easier to bring to court as evidence than to bring in the whole organism... like an elephant!!! SOLVE THIS CASE The day after Halloween, a zookeeper entered the Milwaukee Zoo and started to feed the animals in the cages. Suddenly he found part of the outer fence broken and a small trail of blood leading to the walrus cage. As he entered the walrus cage, he screamed in fright. He saw one of the walruses decapitated. Once he stopped screaming he called 911, and a police officer came over immediately. The officer found blood on the floor of the cage and on the top of the broken fence. He also found pieces of fur with a small amount of skin attached on the ground in the cage. All of these pieces of evidence were collected and analyzed in the Milwaukee Crime Lab. As the officer was cruising around the neighborhood, he noticed something red in the road. As he got off his motorcycle, he noticed it was a large smear of something that looked like blood. It looked as if someone had tried to wash it off of the road. He thought to himself, "Is this real blood or fake Halloween blood"? He decided to assume the worst and get a warrant and investigate the homes on that street. At house #1 he found some blood in the garage, on an old, dirty table. The resident of the house claimed he recently hit his thumb with a hammer. The officer found his thumb to be neither black nor blue. Very suspicious the officer thought!!! He was then considered as suspect #1 and a blood sample of the man was taken as more evidence. As he left the garage he tripped over some dirty hunting clothes. At house #2 the officer found an axe hidden underneath some old greasy towels. It had no blood on it (if it did, this case would be too easy!!!!) But, it did appear to have some skin on it with some white, hard material as well. The officer was thinking that maybe the white substance was part of a walrus tusk. The skin and possible tusk were collected and used as evidence against this new suspect, now known as suspect #2. The officer also noticed a large cut on the suspect's arm. A blood sample was also taken from the man. The officer was unable to find any more evidence in the neighborhood. So he decided question the employees of the zoo. There was only one person who worked the night shift on the night of the crime. She claimed she didn't hear anything because she was waxing floors all night and had her ear plugs in. "Hmm...", the officer thought. It seemed odd to him that she didn't take any breaks during the night... and why would she be waxing the floors of the cages anyway??!! He looked down at her hands and noticed something underneath her fingernails. It looked like hair or fur, which he collected as evidence. She now became suspect #3.

14 The officer continued to look for the missing head and was unsuccessful. He suspected that the tusks were sold on the black market. The rest of the evidence was sent to UW-Whitewater for PCR-RFLP of locus 1, PCR-RFLP of locus 2, and Sequencing analyses.

15

16 The evidence collected included: 1) possible blood, hair and skin from inside the cage. 2) possible blood on top of the fence. 3) possible blood from house #1. 4) blood from suspect #1. 5) possible skin and tusk from house #2. 6) blood from suspect #2. 7) possible hair from suspect #3. 8) possible blood from the street. Results: 1) Can you identify the skin, tusk, fur and all of the blood samples from each crime scene? 2) Did suspect #1, #2, and/or #3 seem guilty? State your evidence as to why or why not, for each suspect.

17 If you were on the jury at the trial, would you ultimately convict any of these suspects? Is it just circumstantial evidence?