Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
|
|
|
- Katherine Barnett
- 6 years ago
- Views:
Transcription
1 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015
2
3 The $1,000 genome is here!
4 Bioinformatics bottleneck
5 Bioinformatics challenges Methods: How do I analyze my data using procedures for various data types? Infrastructure: Where do I process my data? Large scale compute accessibility, Installing and maintaining software Standards: How do I ensure my results are useful? Common, shared formats using community developed software and tools
6 High throughput sequencing map
7 The case for cloud computing in genome informatics
8 The case for cloud computing in genome informatics
9 The case for cloud computing in genome informatics
10 The National Center for Biotechnology Information Bethesda,MD Created in 1988 as a part of the National Library of Medicine at NIH Establish public databases Research in computational biology Develop software tools for sequence analysis Disseminate biomedical information
11 The NCBI microbial annotation pipeline 1. Ab initio prediction of coding sequences: GeneMark and Glimmer Standalone Tools 2. Automated annotation: NCBI Prokaryotic Genome Automatic Annotation Pipeline RPS-BLAST, BLASTX, TBLASTN
12 The NCBI microbial annotation pipeline
13 Other genomic resources Protein Clusters
14 Other genomic resources Protein Clusters
15 Genome Annotation Checks (complete genomes) Why do we need to perform checks? garbage in garbage out We want to provide a tool that will check the annotation of a genome for anomalies that need to be examined further a measure of genome annotation Functions in conjunction with existing tools built into Sequin and checks made by GenBank staff during the submission process
16 Genome Annotation Checks (complete genomes) Takes input genomic file (ASN.1 format) Nucleotide sequence extracted trnascan used to search for missing trnas BLAST search - against all RefSeq proteins from complete genomes (E<10-6 ) RPS-BLAST against all Conserved Domain profiles (E<10-2 )
17 Genome Annotation Checks (complete genomes) Current submission 1. Potential frameshifts 2. RNA-CDS overlaps 3. CDS-CDS overlap 4. RNA-RNA overlap 5. missing trnas (complete) 6. missing rrna (5S, 16S, 23S) 7. truncated proteins (partial domain overlaps)
18 1. Potential frameshifts two or more adjacent genes encoding proteins that hit the same subject from BLAST results 5 Protein1 Protein2 3 Common BLAST hit spanning both proteins Protein3 Protein4
19 2. CDS-RNA Overlap RNAs completely overlapping (+/- strand) CDS and vice versa 5 Protein1 3 5 RNA2 3
20 3. CDS-CDS Overlap CDS completely overlapping (+/- strand) CDS 5 Protein1 3 5 Protein2 3
21 Use in RefSeq Missing or absent structural ribosomal RNAs were detected in all complete prokaryotic genomes (5S, 16S, 23S) Internal ribosomal RNA database is used for BLAST searches High scoring potential rrna is aligned against internal db Analyzed for missing, strand mismatches, length mismatches Currently added semiautomatically (automatically in the future)
22 Data Exchange EcoCyc publications protein interactions EcoGene publications gene locations, gene names, verified N-terminii PseudoCAP publications REBASE publications, protein names BRC preliminary data KEGG pathways, ortholog groups
23 How the Genome has changed? More complex genome structures (chromosomes, organelles, plasmids) Genome sequencing NextGen sequencing More complex genome assembly (chromosomes, scaffolds, contigs) Genome-scale projects - (transcriptome, exome, epigenomics, proteomics) Multi-isolate genome sequencing - (1001 Arabidopsis, 1000 human genomes) Meta-genomes Now useful for drug development
24 New resources at NCBI
25 New genomic resources at NCBI
26 New resources at NCBI
27 Why do we need new databases? Taxonomy BioSample BioProject Genome Assembly Nucleotide
28 BioProject, Genome, Assembly BioProject is an administrative object (defined by goal, target, funding, collaboration) Genome is a biological object defining an organism at molecular level Genome assembly is a complex data structure that defines the structure, relative position (scaffold) and chromosome placement of DNA sequences originated from a single sample
29 What is a Genome project? Genome project is a scientific endeavor that ultimately aims to determine the complete genome sequence of an organism and Aims to annotate protein-coding genes and other important genome-encoded features and Aims to understand the biology, physiology, and evolution of the organism.
30 Genome Project -> BioProject Random survey Metagenome Targeted sequencing Variant Discovery Population genomics Genome sequencing Ecosystem genomics Epigenomics Assembly Transcriptome sequencing Proteomics Annotation
31 BioProject data model Target Scope Objective Capture Mono-isolate Multi-isolate Multi-species Environmental Mono-isolate Multi-isolate Multi-species Environmental Mono-isolate Multi-isolate Multi-species Environmental Material Method DNA RNA Protein sequencing array proteomics
32 Why do we need a database of genome assemblies? We are in a period of extraordinary growth in genomics data. To get the full benefit from all this data, it is important that users can integrate data from different sources. Integration only works, if users know whether or not the different data were reported in the same coordinate system.
33 TB H37Rv Sanger vs. Broad Broad assembly (NC_018143) Sanger assembly (NC_000962)
34 Mycobacterium genomes at NCBI
35 Mycobacterium tuberculosis genomes
36 Mycobacterium tuberculosis overview
37 Mycobacterium tuberculosis genome annotation
38 Mycobacterium tuberculosis H37Rv
39 Mycobacterium tuberculosis H37Rv browser From the Gene record
40 Mycobacterium tuberculosis H37Rv GenePlot
41 BioProject, BioSample, Genome, Assembly, Nucleotide BioProject Single isolate Genome BioSample Assembly Nucleotide BioProject Single isolate Genome BioSample Assembly Nucleotide BioProject Single isolate Genome BioSample Assembly Assembly Assembly Nucleotide BioProject Multi isolate Genome BioSample BioSample BioSample BioSample Assembly Assembly Assembly Assembly Nucleotide SRA
42 NCBI genome submission dataflow metadata BioProject Common Submission Interface BioSample Sequence data SRA GenBank Contigs Genome Collection
43 Virtual machines in cloud environments Running the pipeline happens on the local machine, while the heavy lifting is done on the cloud/cluster
44 CloVR is a Virtual Machine Virtual Machine Pipelines: CloVR-Search CloVR-Microbe CloVR-16S CloVR-Metagenomics Angiuoli, et al. (2011) CloVR: a virtual machine for automated and portable sequence analysis from the desktop using cloud computing. BMC Bioinformatics
45 CloVR Architecture
46 Galaxy on the cloud Get Galaxy without the data or usage limitations. Combine with Cloud BioLinux to have access to MANY tools. Create an analysis cluster in minutes. Use autoscaling to get good performance at low cost.
47 Deploying Galaxy cluster on AWS
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
Prokaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine
1 Abstract A prokaryotic annotation pipeline was developed to automatically annotate draft and complete bacterial genomes. The protein coding genes in the genomes are predicted by the combination of Glimmer
GREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
Gene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
Bacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
A Prac'cal Guide to NCBI BLAST
A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
Genetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
Applied bioinformatics in genomics
Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics
LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
What is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
Introduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
Introduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
Gene Prediction: Preliminary Results
Gene Prediction: Preliminary Results Outline Preliminary Pipeline Programs Program Comparison Tests Metrics Gene Prediction Tools: Usage + Results GeneMarkS Glimmer 3.0 Prodigal BLAST ncrna Prediction
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Introduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
Overview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
From Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Introduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
BIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Bioinformatic tools for metagenomic data analysis
Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic
Introduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
NGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
Product Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
Bioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
I nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
B I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
BME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
I AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador
I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
Gene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
Gene Prediction Final Presentation
Gene Prediction Final Presentation Final Proposed Pipeline Assembled Genome Protein - coding Gene Prediction Ab Initio Prodigal Glimmer GeneMarkS RNA Gene Prediction ncrna Specific trnascanse (trna) RNAmmer
Biology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Introduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
Workflows and Pipelines for NGS analysis: Lessons from proteomics
Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes
Array-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
Functional Annotation - Faction 2 Background and Strategy
Functional Annotation - Faction 2 Background and Strategy March 8, 2017 Khushbu Patel Karan Kapuria Angela Mo Harrison Kim David Lu Christian Colon Nolan English Bowen Yang Cong Gao RECAP. WE ARE HERE!!
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
MAKER: An easy to use genome annotation pipeline. Carson Holt Yandell Lab Department of Human Genetics University of Utah
MAKER: An easy to use genome annotation pipeline Carson Holt Yandell Lab Department of Human Genetics University of Utah Introduction to Genome Annotation What annotations are Importance of genome annotations
European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives
European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular
Small Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Klinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
Introduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
Applications of HMMs in Epigenomics
I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:
DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
The University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
NGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia
Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
Bioinformatics for Microbial Biology
Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:
Applications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
Gene Prediction. Lab & Preliminary Results. Faction 2 Saturday, March 11, 2017
Gene Prediction Lab & Preliminary Results Faction 2 Saturday, March 11, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee
BGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
Advances in Biomedical Research at Comenius University Bratislava
Advances in Biomedical Research at Comenius University Bratislava Bratislava, Slovakia What is biomedicine? Biomedicine is a branch of medical science that applies biological and other natural-science
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
2/19/13. Contents. Applications of HMMs in Epigenomics
2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Protein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
GeneMarkS-2: Raising Standards of Accuracy in Gene Recognition
GeneMarkS-2: Raising Standards of Accuracy in Gene Recognition Alexandre Lomsadze 1^, Shiyuyun Tang 2^, Karl Gemayel 3^ and Mark Borodovsky 1,2,3 ^ joint first authors 1 Wallace H. Coulter Department of
CBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
Introduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
High peformance computing infrastructure for bioinformatics
High peformance computing infrastructure for bioinformatics Scott Hazelhurst University of the Witwatersrand December 2009 What we need Skills, time What we need Skills, time Fast network Lots of storage