BLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences.
|
|
- Leona Preston
- 6 years ago
- Views:
Transcription
1 BLAST Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. An example could be aligning an mrna sequence to genomic DNA. Proteins are frequently composed of functional domains repeated in many different proteins. These parts are most likely to be conserved. BLAST Since DNA databases can be very large, searching for the optimal alignment to all sequences can take too long. BLAST is a heuristic algorithm. Heuristic algorithms find a match reasonably close to the optimal one in a much shorter time than the full dynamic programming. The alignment can then separately be verified / refined using dynamic programming. 1
2 How BLAST works The query sequence is divided into subsequences of a given length. word size 3 for proteins, 11 for nucleotides. These are used to look for exact or nearly exact matches in the sequence database. Fast to do = computationally inexpensive. When a match is found, it is extended further. Word size (W=3) KRISTIAN KRISTIAN KRISTIAN KRISTIAN KRISTIAN KRISTIAN Q u e r y Seeding Search space Database Word hits Alignment Gapped alignment 2
3 Threshold in seeding Word hit Hit is two matching, identical words, one in database, another in the query sequence (used in blastn) Hit is a neighborhood (used in protein-related searches) The neighborhood of a word contains the word itself and all other words whose score is at least as big as T (threshold) when compared via the scoring matrix. For example, if T=13, word=pqg, matrix=blosum62, only words getting a score over 13 will be scored as hits: PQG-PEG (15) is accepted, but PQG-PQA (12) is not. Setting T higher will remove more word hits, making BLAST run faster, but increases the chance of missing an interesting alignment. Setting W (wordsize) higher will decrease sensitivity (chance of finding the alignment), but increase speed of the search. 3
4 Extension Word hits found during seeding are extented from their ends. Extension is stopped when the alignment score drops, or in newer implementations, when the alignment score has dropped enough (drop-off score) compared to its previous maximum. Alignment Word hit Extension Extension, example drop off score KRISTIAN gap=0, X=2 -RISTISANA BLOSUM <- BLOSUM62 values <- Score <- Drop off score Extension terminates when drop off score falls below X. 4
5 Evaluation When the extension stage has produced the alignments, they will be evaluated to determine whether they are statistically significant. Statistical significance is determined using Karlin-Altschul statistics (the E-score) Some simplifying assumptions are made (such as sequences inifinitely long, no gaps), but in practice, K- A statistics is nicely generalizable. E-score The lower the E-score, the more significant the alignment The E-score is dependent on both the database size and the scoring system (substitution matrix, gap penalties). If these are changed, the E-score for a specific alignment will also change. 5
6 Karlin-Altschul statistics E value. E = Kmne S E = number of alignments reaching score S just by chance K = minor constant m = the length of query sequence n = the length of the database e (neperin luku) 2,71 S = normalized alignment score (S is the score, lambda is the normalization factor) NOTE: When E is very small, it can be interpreted equivalently to p-value! Karlin-Altschul, example What is the chance that when two equally long (250) amino acid sequences are aligned using PAM250 matrix, the alignment score is 75? E = Kmne S = 0,1*250*250*2,71 -(0,229*75) = 0,
7 Disadvantages of BLAST When expected sequence similarity drops below 80%, nucleotide-nucleotide blast no longer performs that well. Many significant homologies are missed due to the initial word size requirement. If initial words are allowed to be discontinuous, matching is improved. Discontinuous initial words For instance, require 11 positions out of 21 consecutive nucleotides to be homologous 7
8 Filtering out repeats The human genome (like most others) contains large amounts of repetitive DNA. (LINE, SINE, Alu, et.c.) If the query sequence contains repeats, many homologies identified will be to other sequences containing repeats. Repeats should in most instances be masked out. Usually represented as AATAGNNNNCGC Different varieties of BLAST DNA query against a database of DNA sequences (blastn). Protein query against protein sequences (blastp). DNA query translated in six reading frames against a protein database (blastx). Megablast, for large and closely related sequences. 8
9 Blastn and Megablast Typically used for identifying your sequence. Megablast is a fast alternative for finding nearly exact matches. Blastn is better at finding somewhat diverged sequences (e.g. from a related species). Blastx and tblastx Blastx translates the query sequence in all reading frames and compares it to a protein database. Aggregate statistics are provided for all reading frames. Tblastx queries a translated DNA sequence against a database of translated DNA sequences. Also produces aggregate statistics for all reading frames. 9
10 BLAST programs Query Database Program Typical uses DNA DNA blastn Annotation, mapping oligonucleotides to genome protein protein blastp Identifying common regions in proteins translated DNA protein blastx Finding protein-coding genes in genomic DNA protein translated DNA tblastn Identifying transcripts, possibly from multiple organisms translated DNA translated DNA tblastx Cross-species gene prediction, searching for genes not yet in megablast protein databases Large and closely related sequences Specialized BLAST Choose a type of specialized search (or database name in parentheses): Make specific primers with Primer-BLAST (Finding primers specific to your PCR template Find conserved domains in your sequence (cds) Find sequences with similar conserved domain architecture (cdart) Search sequences that have gene expression profiles (GEO) 10
11 ... Search immunoglobulins (IgBLAST) Screen sequence for vector contamination (vecscreen) Align two (or more) sequences using BLAST (bl2seq) Search protein or nucleotide targets in PubChem BioAssay Search SRA transcript and genomic libraries Constraint Based Protein Multiple Alignment Tool Needleman-Wunsch Global Sequence Alignment Tool Search RefSeqGene Search WGS sequences grouped by organism Yet more varieties PSI-Blast (Position Specific Iterated Blast) for very sensitive protein sequence against protein database searches (käyttötarkoitus: samaan proteiiniperheeseen kuuluvien proteiinien haku) PHI-Blast (Pattern-Hit Initiated Blast): hakusekvenssistä etsitään ensin käyttäjän antama pattern, jota sitten haetaan tietokannasta... 11
12 ...miten valita omaan tarkoitukseen sopivin blast-versio?! Apua ohjelman valintaan: 12
BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments
BLAST 100 times faster than dynamic programming. Good for database searches. Derive a list of words of length w from query (e.g., 3 for protein, 11 for DNA) High-scoring words are compared with database
More informationCAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU
CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU !2 Sequence Alignment! Global: Needleman-Wunsch-Sellers (1970).! Local: Smith-Waterman (1981) Useful when commonality
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationExercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationEvolutionary Genetics. LV Lecture with exercises 6KP
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted
More informationMatch the Hash Scores
Sort the hash scores of the database sequence February 22, 2001 1 Match the Hash Scores February 22, 2001 2 Lookup method for finding an alignment position 1 2 3 4 5 6 7 8 9 10 11 protein 1 n c s p t a.....
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationMaking Sense of DNA and Protein Sequences. Lily Wang, PhD Department of Biostatistics Vanderbilt University
Making Sense of DNA and Protein Sequences Lily Wang, PhD Department of Biostatistics Vanderbilt University 1 Outline Biological background Major biological sequence databanks Basic concepts in sequence
More informationA Prac'cal Guide to NCBI BLAST
A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities
More informationBasic Local Alignment Search Tool
14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html
More informationDatabase Searching and BLAST Dannie Durand
Computational Genomics and Molecular Biology, Fall 2013 1 Database Searching and BLAST Dannie Durand Tuesday, October 8th Review: Karlin-Altschul Statistics Recall that a Maximal Segment Pair (MSP) is
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationAlignment to a database. November 3, 2016
Alignment to a database November 3, 2016 How do you create a database? 1982 GenBank (at LANL, 2000 sequences) 1988 A way to search GenBank (FASTA) Genome Project 1982 GenBank (at LANL, 2000 sequences)
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationNCBI Molecular Biology Resources
NCBI Molecular Biology Resources Part 2: Using NCBI BLAST December 2009 Using BLAST Basics of using NCBI BLAST Using the new Interface Improved organism and filter options New Services Primer BLAST Align
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationBIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationB L A S T! BLAST: Basic local alignment search tool 11/23/2010. Copyright notice. November 29, Outline of today s lecture BLAST. Why use BLAST?
November 29, 2010 BLAST: Basic local alignment search tool B L A S T! Jonathan Pevsner, Ph.D. Bioinformatics pevsner@kennedykrieger.org Johns Hopkins School of Medicine Copyright notice Many of the images
More informationDynamic Programming Algorithms
Dynamic Programming Algorithms Sequence alignments, scores, and significance Lucy Skrabanek ICB, WMC February 7, 212 Sequence alignment Compare two (or more) sequences to: Find regions of conservation
More informationSmall Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
More informationSingle alignment: FASTA. 17 march 2017
Single alignment: FASTA 17 march 2017 FASTA is a DNA and protein sequence alignment software package first described (as FASTP) by David J. Lipman and William R. Pearson in 1985.[1] FASTA is pronounced
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationBIO 4342 Lecture on Repeats
BIO 4342 Lecture on Repeats Jeremy Buhler June 14, 2006 1 How RepeatMasker Works Running RepeatMasker is the most common first step in annotating genomic DNA sequences. What exactly does it do? Given a
More informationHC70AL Spring 2011! An Introduction to Bioinformatics! By!! Brandon Le! April 7, 2011!
HC70AL Spring 2011! An Introduction to Bioinformatics! By!! Brandon Le! April 7, 2011! Outline 1. Review of Dideoxy Sequencing 2. Obtaining and Processing DNA Sequences 3. What is a Gene? 4. Sequence Analysis
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationGenomics I. Organization of the Genome
Genomics I Organization of the Genome Outline Organization of genome Genomes, chromosomes, genes, exons, introns, promoters, enhancers, etc. Databases Why do we need them? How do we access them? What can
More informationMOL204 Exam Fall 2015
MOL204 Exam Fall 2015 Exercise 1 15 pts 1. 1A. Define primary and secondary bioinformatical databases and mention two examples of primary bioinformatical databases and one example of a secondary bioinformatical
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationHC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) HC70AL Spring 2004 An Introduction to Bioinformatics -- Part I By Brandon Le April 6, 2004 What is a Gene? An ordered sequence of nucleotides What are the 4
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationAnnotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
More informationG4120: Introduction to Computational Biology
ICB Fall 2009 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2009 Oliver Jovanovic, All Rights Reserved. Analysis of Protein
More informationModern BLAST Programs
Modern BLAST Programs Jian Ma and Louxin Zhang Abstract The Basic Local Alignment Search Tool (BLAST) is arguably the most widely used program in bioinformatics. By sacrificing sensitivity for speed, it
More informationUNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics
UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, 2010 SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics DURATION: 3 HOURS TOTAL MARKS: 125 Internal Examiner: Dr. Ché Pillay External Examiner: Prof. Nicola
More informationWhat is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationCreation of a PAM matrix
Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental
More informationLecture 17: Heuris.c methods for sequence alignment: BLAST and FASTA. Spring 2017 April 11, 2017
Lecture 17: Heuris.c methods for sequence alignment: BLAST and FASTA Spring 2017 April 11, 2017 Mo.va.on Smith- Waterman algorithm too slow for searching large sequence databases Most sequences are not
More informationSequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1
Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,
More informationGene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton
Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationBioinformatics with basic local alignment search tool (BLAST) and fast alignment (FASTA)
Vol. 6(1), pp. 1-6, April 2014 DOI: 10.5897/IJBC2013.0086 Article Number: 093849744377 ISSN 2141-2464 Copyright 2014 Author(s) retain the copyright of this article http://www.academicjournals.org/jbsa
More informationHot Topics. What s New with BLAST?
Hot Topics What s New with BLAST? Slides based on NCBI talk at American Society of Human Genetics October 2005 Hot Topics Outline I. New BLAST Algorithm: Discontiguous MegaBLAST II. New Databases III.
More informationLast Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
More informationIntroduction to sequence similarity searches and sequence alignment
Introduction to sequence similarity searches and sequence alignment MBV-INF4410/9410/9410A Monday 18 November 2013 Torbjørn Rognes Department of Informatics, University of Oslo & Department of Microbiology,
More informationFINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)
FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.
More informationFUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
More informationImaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized
1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationWhy study sequence similarity?
Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:
More informationGenomic region (ENCODE) Gene definitions
DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationApplication for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick
Application for Automating Database Storage of EST to Blast Results Vikas Sharma Shrividya Shivkumar Nathan Helmick Outline Biology Primer Vikas Sharma System Overview Nathan Helmick Creating ESTs Nathan
More informationHC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet
HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet NAME: DATE: QUESTION ONE Using primers given to you by your TA, you carried out sequencing reactions to determine the identity of the
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationEntrez and BLAST: Precision and Recall in Searches of NCBI Databases
Previous Contents Next Issues in Science and Technology Librarianship Fall 2007 DOI:10.5062/F47P8WBF URLs in this document have been updated. Links enclosed in {curly brackets} have been changed. If a
More informationFiles for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
More informationIdentifying Regulatory Regions using Multiple Sequence Alignments
Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html
More informationGene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
More informationWSSP-10 Chapter 9 Determine ORF and BLASTP
WSSP-10 Chapter 9 Determine ORF and BLASTP Steps and terms used in protein expression 1 st ATG in mrna p 9-1 Cloning the cdna library p 9-1 Possible reading frames p 9-2 Possible types of clones in the
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationThe use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015
The use of bioinformatic analysis in support of HGT from plants to microorganisms Meeting with applicants Parma, 26 November 2015 WHY WE NEED TO CONSIDER HGT IN GM PLANT RA Directive 2001/18/EC As general
More informationPREDICT Host DNA Barcoding Guide
PREDICT Host DNA Barcoding Guide Contents: 1. Rationale for Barcoding.. Page 2 2. Implementation... Page 2 3. PCR Protocols.... Page 3 4. Data Interpretation... Page 5 5. Data Entry into EIDITH.... Page
More informationBacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
More informationAnnotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
More informationAnnotation of a Drosophila Gene
Annotation of a Drosophila Gene Wilson Leung Last Update: 12/30/2018 Prerequisites Lecture: Annotation of Drosophila Lecture: RNA-Seq Primer BLAST Walkthrough: An Introduction to NCBI BLAST Resources FlyBase:
More informationExercises (Multiple sequence alignment, profile search)
Exercises (Multiple sequence alignment, profile search) 8. Using Clustal Omega program, available among the tools at the EBI website (http://www.ebi.ac.uk/tools/msa/clustalo/), calculate a multiple alignment
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More informationAaditya Khatri. Abstract
Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database
More informationG4120: Introduction to Computational Biology
ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding
More information(a) (3 points) Which of these plants (use number) show e/e pattern? Which show E/E Pattern and which showed heterozygous e/e pattern?
1. (20 points) What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c) Methods of detection (such as gel electrophoresis,
More informationExploring the Genetic Basis for Behavior. Instructor s Notes
Exploring the Genetic Basis for Behavior Instructor s Notes Introduction This lab was designed for our 300-level Advanced Genetics course taken by juniors and seniors majoring in Biology or Biochemistry.
More informationMetaGO: Predicting Gene Ontology of non-homologous proteins through low-resolution protein structure prediction and protein-protein network mapping
MetaGO: Predicting Gene Ontology of non-homologous proteins through low-resolution protein structure prediction and protein-protein network mapping Chengxin Zhang, Wei Zheng, Peter L Freddolino, and Yang
More informationComputational Molecular Biology. Lecture Notes. by A.P. Gultyaev
Computational Molecular Biology Lecture Notes by A.P. Gultyaev Leiden Institute of Applied Computer Science (LIACS) Leiden University January 2017 1 Contents Introduction... 3 1. Sequence databases...
More informationAgenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018
Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson
More informationA History of Bioinformatics: Development of in silico Approaches to Evaluate Food Proteins
A History of Bioinformatics: Development of in silico Approaches to Evaluate Food Proteins /////////// Andre Silvanovich Ph. D. Bayer Crop Sciences Chesterfield, MO October 2018 Bioinformatic Evaluation
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationIntroduction to BLAST
Introduction to BLAST PowerPoint by Ananth Kalyanaraman School of Electrical Engineering and Computer Science Washington State University SC08 Education Sequence Comparison for Metagenomics 1 About the
More informationTypically, to be biologically related means to share a common ancestor. In biology, we call this homologous
Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous. Two proteins sharing a common ancestor are said to be homologs. Homologyoften implies structural
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More information