Low cost and non-toxic genomic DNA extraction for use in molecular marker studies.

Size: px

Start display at page:

Download "Low cost and non-toxic genomic DNA extraction for use in molecular marker studies."

Barbara Morgan
6 years ago
Views:

1 Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and adapt a method for low cost and non-toxic genomic DNA extraction for use in molecular marker studies. We have developed a DNA isolation method based on binding of DNA to silica powder under chaotropic conditions. The steps of the method involve lysis of plant material, binding of DNA to silica powder, washing and finally elution of DNA from the silica powder. We have tested the method in several plant species and show the applicability of such DNA preparations for molecular marker studies in barley. 2. MATERIALS MATERIALS FOR LOW-COST DNA EXTRACTIONS Suppliers and catalogue numbers (where appropriate) Celite 545 silica powder (Celite 545-AW reagent grade) Supelco U SDS (Sodium dodecyl sulfate) for mol biol approx 99% Sigma L G Sodium acetate anhydrous Sigma S-2889 (MW=82.03g/mol) NaCl (Sodium chloride) Sigma S KG (MW=58.44g/mol) RNase A Qiagen RNase A (100 mg/ml) Ethanol Ethanol absolut for analysis (Merck ) Nuclease-free H2O Gibco ultrapure distilled water (DNase, RNase-free) Guanidine thiocyanate Sigma G9277 (MW=118.2g/mol) Microcentrifuge tubes (1.5mL, 2.0mL) Any general laboratory supplier Micropipettes (1000µL, 200µL, 20µL) Any general laboratory supplier Microcentrifuge Eppendorf Centrifuge 5415D Optional: Shaker for tubes Eppendorf Thermomixer comfort for 1.5mL tubes MATERIALS FOR GRINDING OF LEAF MATERIAL (depending on grinding method) Liquid nitrogen Mortar and pestle, TissueLyser, e.g. Qiagen TissueLyser II Metal beads (tungsten carbide beads, 3mm) Qiagen Cat.No EVALUATION OF DNA YIELD AND QUALITY DNA concentration Agarose gel equipment ND-NanoDrop 1000 Spectrophotometer Horizontal electrophoresis from any general laboratory supplier LOW COST AND NON-TOXIC GENOMIC DNA EXTRACTION FOR USE IN MOLECULAR MARKER STUDIES. VERSION 1.4, PLANT BREEDING AND GENETICS LABORATORY

2 Page 2 SSR MARKER ANALYSIS Thermocycler Biorad C1000 Thermal cycler PCR tubes Life Science No ataq DNA polymerase (5U/µl) Promega PCR buffer without MgCl2, 10x conc Roche MgCl2 stock solution (25 mm) Roche PCR Nucleotide mix (10 mm) Promega Agarose gel equipment Horizontal electrophoresis from any general laboratory supplier SOLUTIONS TO PREPARE: BUFFER Receipt Comments STOCK SOLUTIONS 5M NaCl stock solution 3M Sodium acetate (ph = 5.2) MW=58.44g/mol 29.22g / 100mL MW=82.03g/mol 24.61g / 100mL Do not use if percipitate forms. Either heat to get fully back into solution or discard and make fresh Adjust ph value with glacial acetic acid 95% (v/v) Ethanol 95 ml ethanol abs + 5 ml H2O Use fresh. Ethanol absorbs water and the % will drop over time. Tris-EDTA (TE) buffer (10x) Composition: For 100mL (10x): Can make Tris and EDTA from 100mM Tris-HCl, ph= mm EDTA 10mL of 1M Tris- HCl stock 2mL of 0.5M powders. This may be less costsly. However, note that the ph of Tris changes with temperature. EDTA stock LYSIS BUFFER (standard) DNA BINDING BUFFER 0.5% SDS (w/v) in 10x TE 0.5g SDS /100mL 6M Guanidine thiocyanate MW = g/mol g / 100mL (6M)!!! it takes several hours until dissolved (leave it approx. 4-5 hours) WASH BUFFER 1mL of 5M NaCl + 99mL of 95% EtOH!!! PREPARE FRESH, because the salt precipitates during storage DNA ELUTION BUFFER depending on application (e.g. TEbuffer; Tris-HCl buffer)

3 Page 3 3. METHODS (method for centrifuge tubes): PREPARATION OF SILICA POWDER-DNA BINDING SOLUTION Fill silica powder (Celite 545 silica) into 50 ml Falcon-tube (to about 2.5mL = approx. 800mg) Add 30 ml dh 2O Shake vigorously (vortex and invert) Let slurry settle for approx. 15 min Remove (pipette off) the liquid Repeat 2 times (a total of 3 washes) After last washing step: resuspend the silica powder in about the same amout of water (up to about 5 ml) STORE the silica solution at RT until further use (silica : H 2O = 1 : 1) Before use: suspend stored silica solution (silica : H 2O = 1 : 1) by vortexing Transfer ~50 µl of silica solution to 2mL tubes (prepare 1 tube per sample)!! try to keep the silica suspended during pipetting to ensure an equal distribution Add 1mL H 2O (a final wash step) Mix by vortexing Centrifuge: full speed (13,200) for sec Pipette off liquid Add 700 µl DNA binding buffer (6M Guanidine thiocyanate) Suspend the silica powder in DNA binding buffer The silica binding solution is now ready for further use in the protocol (see Methods) PREPARATIONS Prepare 2 ml tubes (1 per sample): add 3 metal beads (tungsten carbide beads) per tube Harvest leaf material (starting amount of material: about 100 mg fresh weight) GRINDING Use appropriate / available grinding protocol (Mortar & pestle, Qiagen TissueLyser) e.g. grinding using Qiagen TissueLyserII: Freeze 2mL tubes containing leaf material and 3 metal beads in liquid nitrogen Grind in TissueLyser by shaking (10 sec at 1/30 speed) Re-freeze in liquid nitrogen (>30 sec) Grind again in TissueLyser by shaking (10 sec at 1/30 speed) Re-freeze in liquid nitrogen (>30 sec) Keep in liquid nitrogen until lysis buffer is added or store at -80 C for later use

4 Page 4 LYSIS Add 800 µl Lysis buffer Add 4 µl RNaseA (100 mg/ml) Vortex (~2 min until the powder is dissolved in the buffer) Incubate: 10min at room temperature Add 200 µl 3M Sodium Acetate (ph = 5.2) Mix by inversion of tubes Incubate on ice for 5 min Centrifuge 13,200 rpm / 5 min / RT (pellet the leaf material) DNA BINDING prepare 700 µl silica binding solution (see above) transfer 800 µl of the supernatant to the tubes containing silica binding solution)!! Do not transfer leaf material! Completely resuspend the silica powder by vortexing and inversion of tubes (ca 20 sec) incubate 15 min at RT (on a shaker at 400 rpm and/or invert tubes from time to time) Centrifuge 13,200 rpm / 3 min / RT (pellet the silica) Remove the supernatant (with pipette) WASHING (2 times) Add 500 ml wash buffer (prepared fresh) Completely resuspend the silica powder by vortexing and inversion of tubes (approx. 20 sec) Centrifuge 13,200 rpm / 3 min / RT (pellet the silica) Repeat the washing step (optional: a third washing step) Remove the supernatant with pipette (as complete as possible) optional: short spin and remove residual liquid with pipette After last washing step: dry the silica in the hood up to 1 hour at RT (make sure there is no wash buffer left) RESUSPENSION Add 200µL TE buffer or 10mM Tris buffer Completely resuspend the silica powder by vortexing and inversion of tubes (approx. 20 sec) Incubate: 20 min / RT / with gentle agitation (on a shaker at 400 rpm and/or invert tubes from time to time) Centrifuge (for tubes): 13,200 rpm / 5 min / RT (pellet the silica) transfer 180 µl supernatant to new tube (avoid transferring silica powder!) optional: if there is still silica powder in the preps repeat the centrifugation check for concentration and integrity of DNA store the genomic DNA at -20 C for long-term storage or 4 C for short-term storage

Page 5 4. EXAMPLE RESULTS DNA concentrations and yields using silica powder-based DNA extraction method with different combinations of buffers Table 1.

5 Page 5 4. EXAMPLE RESULTS DNA concentrations and yields using silica powder-based DNA extraction method with different combinations of buffers Table 1. Different combinations of self-made buffers and buffers from Qiagen DNeasy Plant Mini kit Sample A B A B A B A B Lysis Dneasy kit* +Shredder -Shredder Dneasy kit* +Shredder -Shredder DNA binding buffer Buffer AP3/E* Buffer AP3/E* DNA wash buffer Buffer AW* Wash buffer Dneasy kit* +Shredder -Shredder Dneasy kit* +Shredder -Shredder Lysis buffer (our method) Lysis buffer (our method) Lysis buffer (our method) 6M 6M Buffer Buffer 6M Guanidine Guanidine AP3/E* AP3/E* Guanidine thiocyanate thiocyanate thiocyanate Lysis buffer (our method) 6M Guanidine thiocyanate Buffer AW* Wash buffer Buffer AW* Wash buffer Buffer AW* Wash buffer DNA concentration (ng/µl) Total yield (µg) *components of Qiagen DNeasy Plant Mini kit Quality of genomic DNA obtained by silica powder-based DNA extraction method L A 5B 6A 6B 7A 7B 8A 8B Figure 1. Quality of barley genomic DNA extractions using silica powder and different combinations of self-made (low-cost) buffers and buffers provided by Qiagen DNeasy kit. 8 µl of each genomic DNA extraction were separated on a 0.7% agarose gel.

6 Page 6 1-8: Barley genomic DNA preparation +: using QIAshredder for the preparation of barley leaf lysates (lysis procedure following the kit instructions) -: preparation of leaf lysates using the kit instruction (but without using QIAshredder A, B: technical replicates L: size standard (1 kb Plus DNA ladder - Invitrogen) All of the genomic DNA preparations show similar DNA concentrations (Table 1) and a good quality of the genomic DNA on the agarose gel (Figure 1). Only the DNA preparations 2+ and 2- (buffer components from the kit in combination with our wash buffer) show clearly higher concentrations and yields (about 2-3 times higher) than all other DNA preparations. These results indicate that by modifications of the protocol (i.e. modifications of buffers) some improvements of the DNA yields are possible. The DNA preparations of samples 8A and 8B were extracted exclusively with self-made (low-cost) buffers and show a comparable concentration and yield as the other extractions. Use of barley genomic DNA obtained by the silica powder-based DNA extraction method for marker analysis (SSR marker) The recommended amount of input DNA for SSR analysis are 20ng of DNA. This results in an DNA input volume between 1uL and 5uL per PCR reaction (e.g. samples 8A and 8B : 1.5 and 1.2uL input DNA). We tested primers for the barley SSR marker cln-130, which amplifies a PCR product of an expected size of about 278 bp. Primer sequences: Primer name Sequence cnl130_f AAATGTTGAGCAACGGGAGCT cnl130_r ACTTCATAGGGCGGAGGTCT SSR PCR reactions (Promega ataq) per reaction (reaction volume: 25uL): 10x Taq buffer without MgCl2 2.5 µl MgCl2 (25 mm) 1.5 µl Nucleotide mix (10 mm) 1.0 µl Primer forward (10 µm) 0.8 µl Primer reverse (10 µm) 0.8 µl ataq DNA polymerase (5U/µl) 0.25 µl DNA (20 ng) 1-5 µl H2O (to 25 µl) µl The following PCR program was used ( SSR55mod ): 5 min at 94 C

Page 7 35 cycles (1 min at 94 C; 1 min at 55 C; 30 sec at 72 C) final extension at 72 C for 5 min 1+ 1-2+ 2-3+ 3-4+ 4-5A 5B 6A 6B 7A 7B 8A 8B Figure 2.

7 Page 7 35 cycles (1 min at 94 C; 1 min at 55 C; 30 sec at 72 C) final extension at 72 C for 5 min A 5B 6A 6B 7A 7B 8A 8B Figure 2. SSR-PCR product amplified from barley genomic DNA extractions (obtained by the use of silica powder and different combinations of self-made (low-cost) buffers and buffers provided by Qiagen DNeasy Plant Mini kit for details see Table1). A 5uL-aliquot of each PCR reaction was checked on a 2.0% agarose gel. 1-8: Barley genomic DNA preparation +: using QIAshredder for the preparation of barley leaf lysates (lysis procedure following the kit instructions) -: preparation of leaf lysates using the kit instruction (but without using QIAshredder A, B: technical replicates L: size standard (1 kb Plus DNA ladder - Invitrogen) With the exception of sample 4+, all DNA preparations showed to be suitable for the use in molecular marker analysis (i.e. SSR). All PCR reactions showed a clear band at the expected size. The very weak PCR product of sample 4+ corresponds to the low yield of genomic DNA in this specific sample (see Figure 1 and Table 1). Application of the silica powder-based DNA isolation method to other plant species The genomic DNA of maize, rice and Cassava were isolated using the low-cost silica powder-based method with self-made (low-cost) buffers. 4 technical replicates of each plant species were carried out. Table 2. DNA concentration and yield of silica powder-based genomic DNA preparations isolated from maize, Cassava and rice.

Page 8 Sample M1 M2 M3 M4 C1 C2 C3 C4 R1 R2 R3 R4 DNA concentration (ng/µl) 7.5 6.3 4.7 3.8 37 4.2 13.1 16.1 1.5 1.7 1.1 4.4 Total yield (µg) 1.35 1.13 0.85 0.68 6.66 0.76 2.36 2.9 0.27 0.31 0.2 0.

8 Page 8 Sample M1 M2 M3 M4 C1 C2 C3 C4 R1 R2 R3 R4 DNA concentration (ng/µl) Total yield (µg) M1-4 (maize 1-4); C1-4 (Cassava 1-4); R1-4 (rice 1-4) Maize Cassava Rice L Figure 3. Quality of genomic DNA extractions using silica powder-based DNA isolation method from maize, Cassava and rice. 8 µl of each genomic DNA extraction were separated on a 0.7% agarose gel. 1-4: Technical replicates of each plant species L: size standard (1 kb Plus DNA ladder - Invitrogen) We could successfully apply the silica powder-based extraction method of genomic DNA to several plant species, i.e. maize, cassava and rice. In all of these extractions, genomic DNA was present, although some of the sample showed a very low DNA yield (see Table 2 and Figure 3). The cassava DNA extractions showed the highest yields (up to 37 ng/µl insample C1 ). The maize extractions showed significantly lower yields: between 3.8 and 7.5 ng/µl. The DNA yields from rice were very low ( ng/µl). The quality check on the agarose gel revealed some degradation, although the quality should be sufficient for most standard PCR applications. 5. CONCLUSIONS

9 Page 9 The silica-powder based low-cost DNA isolation method has been tested with the plant species barley, maize, rice and cassava. Especially the DNA extractions from barley worked well and provided highquality genomic DNA and sufficient yield. The applicability of the silica-powder based genomic DNA extractions for molecular marker studies was shown. The pilot experiments with other plant species (maize, rice and cassava) showed the applicability of the silica powder DNA extraction method to different economically important plant species. It provided genomic DNA of suitable quality, but rather low yield. Therefore, some modifications of the protocol to improve yield and/or DNA quality in different plant species may still be necessary (i.e. rice). Further, inconsistent recovery from species such as cassava suggests that further optimizations are required.

Low-cost DNA extraction for use in TILLING and Ecotilling assays

Low-cost DNA extraction for use in TILLING and Ecotilling assays Version 1.3 (January 31, 2013) Plant Breeding and Genetics Laboratory Prepared by Bernhard Hofinger and Bradley Till 1. MATERIALS Company