Bio 101 Sample questions: Chapter 10
|
|
- Sybil Hampton
- 6 years ago
- Views:
Transcription
1 Bio 101 Sample questions: Chapter Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information carried by a DNA molecule is in. A. the RNA units that make up the molecule B. the sugars and phosphates forming its backbone C. the total number of nucleotides it contains D. its amino acid sequence E. the order of the nucleotides in the molecule 3 How does RNA polymerase know where to start transcribing a gene into mrna? A. It looks for a terminator sequence. B. Transfer RNA acts to translate the message to RNA polymerase. C. The ribosome directs it to the correct portion of the DNA molecule. D. It starts at one end of the chromosome. E. It starts at a certain nucleotide sequence of the DNA called a promoter. 4 After an RNA molecule is transcribed from a eukaryotic gene, portions called are removed and the remaining are spliced together to produce an mrna molecule with a continuous coding sequence. A. exons... introns B. caps... tails C. introns... exons D. promoters... terminators E. codons... anticodons
2 5 Which one of the following is true of trnas? A. There are four types of trna. B. trnas carry special sequences known as codons. C. trnas are extremely small molecules. D. Each trna binds a particular amino acid. E. All of the above. 6 Which of the following processes occurs in the cytoplasm of a eukaryotic cell? A. translation and transcription B. DNA replication C. transcription D. translation E. DNA replication and translation 7 The flow of information in a cell proceeds. A. from DNA to RNA to protein B. from RNA to protein to DNA C. from DNA to protein to RNA D. from RNA to DNA to protein E. from protein to RNA to DNA 8 A mutagen immediately causes. A. blockage of the ribosome-binding sites B. a change in the base sequence of DNA C. a reduction in the number of trna molecules available for protein synthesis D. decreased permeability of the nuclear envelope E. problems with mitosis 9 A gene is usually. A. the same thing as a chromosome B. made of protein C. the information for making a polypeptide ( a protein) D. made by a ribosome E. made of RNA
3 10. Which one of the following is NOT associated with RNA? A. uracil B. thymine C. a sugar D. phosphates E. single-strandedness 11 When messenger RNA (mrna) is being made, the RNA base always pairs with the base in DNA. A. T... G B. U... T C. A... U D. U... A E. T... A 12 The DNA code is CGT. What messenger RNA is made from this? A. CTA B. TCU C. ATU D. UCG E. GCA 13 Information is transferred from the nucleus to the cytoplasm of eukaryotic cells in the form of. A. lipids B. sterols C. carbohydrates D. nucleic acids E. proteins 14 The number of nucleotide bases "read" together on the mrna to designate each amino acid is ; this unit is called a. A anticodon B amino acid C triose D dipeptide E codon
4 15 Which one of the following statements is true? A. Each triplet has many different meanings. B. Each gene codes for three proteins. C. Each DNA base codes for three amino acids. D. Each amino acid in a protein is coded for by three bases in the DNA. E. It takes three genes to code for one protein. 16 What is the proper order of the following events in the expression of a eukaryotic gene? 1. translation 2. RNA processing 3. transcription A. 2, 3, 1 B. 1, 2, 3 C. 2, 3, 1 D. 3, 2, 1 E. 1, 2, 3 17 Which one of the following catalyzes the linkage between nucleotides to form RNA? A. trna B. RNA ligase C. RNA D. RNA polymerase E. reverse transcriptase 18 A cell biologist found that two different proteins with largely different structures were translated from two different mrnas. These mrnas, however, were transcribed from the same gene in the cell nucleus. Which mechanism below could best account for this? A. The gene could be transcribed in different directions. B. A mutation might have altered the gene. C. Exons from the same gene could be spliced in different ways to make different mrnas. D. The two proteins have different functions in the cell. E. Different systems of DNA unpacking could result in two different mrnas.
5 19 Which one of the following statements correctly describes mrna processing in eukaryotes? A. Introns are cut out and are then spliced together at the end of the mrna. B. Introns are cut out and transported to the ribosomes. C. Exons are cut out and transported to smooth endoplasmic reticulum. D. Exons are cut out and the introns are spliced together. E. Introns are cut out and the resulting exons are spliced together. 20. In a eukaryotic cell, transcription takes place. A. on free ribosomes B. on the cell membrane C. in the cytoplasm D. in the nucleus E. in the rough endoplasmic reticulum 21 During translation in a eukaryotic cell. A. polypeptides are synthesized at ribosomes, according to instructions carried by mrna B. French cells are able to speak to German cells C. trna carries amino acid molecules to the nucleus, where they are added to a growing polypeptide chain D. ribosomes move into the nucleus E. mrna is synthesized by the bonding of free nucleotides to the bases on the template strand of DNA 22 During the process of translation, matches an mrna codon with the proper amino acid. A. messenger RNA B. DNA polymerase C. ATP D. transfer RNA E. a ribosome
6 23 How do retroviruses such as HIV differ from other viruses? A. They contain nucleic acids that code for proteins. B. They can reproduce only inside living cells. C. They contain DNA that is used as a template to make RNA. D. They contain the enzyme reverse transcriptase. E. They have much simpler reproductive cycles than other RNA viruses Set 2 Sample Questions, Chapter 12 (and viruses, too) 1) A virus that has RNA as its genetic material can use to convert information stored in RNA to information stored in DNA. A) reverse transcriptase B) DNA ligase C) a restriction enzyme D) a terminator enzyme E) RNA polymerase 2) Restriction enzymes are obtained from. A) retroviruses B) eukaryotes C) DNA viruses D) bacteria E) archaea 3) Gel electrophoresis separates DNA fragments on the basis of differences in their. A) G:C ratio B) A:C ratio C) A:G ratio D) G:T ratio E) length 4A) Approximately what percentage of the human genome consists of noncoding DNA? A) 70% B) 80% C) 98% D) 50% E) 60%
7 4B) In recombinant DNA experiments, is used to cut pieces of DNA and joins the resulting fragments to form recombinant DNA. A. a restriction enzyme... DNA ligase B. a reverse transcriptase... a restriction enzyme C. a plasmid... DNA ligase D. DNA ligase... a restriction enzyme E. a reverse transcriptase... a plasmid 5) Which enzyme is used to "paste" DNA fragments together? A. DNA ligase B. DNA polymerase C. restriction enzyme D. transformation enzyme E. nuclease enzyme 6) An enzyme that "cuts" DNA at a specific sequence of bases is called. A. reverse transcriptase B. restriction enzyme C. RNA D. palindrome E. ligase 7) An enzyme that makes DNA from an RNA template is called. A. reverse transcriptase B. a restriction enzyme C. cdna D. a recognition sequence E. ligase 8) Electrophoresis is used to. A. separate fragments of DNA B. clone genes C. cut DNA into fragments D. match a gene with its function E. amplify small DNA samples to obtain enough for analysis
8 9)The polymerase chain reaction (PCR) is a useful technique because it can. A. identify genetic markers for diseases B. make a large amount of DNA from a tiny amount C. directly establish paternity (identify the father of an individual) D. isolate particular genes of interest E. manufacture large amounts of a protein 10) DNA fingerprints used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA fingerprint shows. A. the exact order of all of the bases in a particular gene B. the presence of various-size fragments of DNA C. the presence of dominant or recessive alleles for particular traits D. the order of genes along particular chromosomes E. the presence of viruses in the blood 11) In an experiment similar to the one done in lab, which of these pairs would have exactly the same DNA fragments? A. identical twins B. father and son C. mother and son D. husband and wife E. fraternal twins 12) Much of genetic engineering uses plasmids, which are. A. repeating sequences that protect DNA from digestion when it is inserted into a foreign cell B. small circles of DNA found in bacteria C. segments of RNA that must be attached to DNA before the DNA can replicate D. ends of cut DNA molecules that are "sticky" because they have unpaired base sequences E. infectious proteins
9 13. Electrophoresis is used to. A. separate fragments of DNA B. clone genes C. cut DNA into fragments D. match a gene with its function E. amplify small DNA samples to obtain enough for analysis 14. Putting a human gene into the plasmids of bacteria has enabled scientists to. A. insert the corrected gene into patients who have certain genetic disorders B. use these bacteria to mass-produce mrna for certain genes C. match DNA found at a crime scene to a suspect's DNA D. identify carriers of genetic diseases E. use bacteria as "factories" for protein products such as insulin Answers SET 1: 1. b 2. e 3. e 4. c 5. d 6. d 7. a 8. b 9. c 10. b 11. d 12. e 13. d 14. e 15. d 16. d 17. d 18. c 19. e 20. d 21. a 22. d 23. d
10 Answers to SET 2 1) A 2) D 3) E 4A) C 4B) A 5) A 6) B 7) A 8) A 9) B 10) B 11) A 12) B 13) A 14) E
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More information-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationVersion 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access
Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) 1 This print-out should have 34 questions. Multiple-choice questions may continue on the next column or page find all choices
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationPROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationUNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
More informationChapter 4 DNA Structure & Gene Expression
Biology 12 Name: Cell Biology Per: Date: Chapter 4 DNA Structure & Gene Expression Complete using BC Biology 12, pages 108-153 4.1 DNA Structure pages 112-114 1. DNA stands for and is the genetic material
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationDESIGNER GENES SAMPLE TOURNAMENT
DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationDNA Function. DNA Heredity and Protein Synthesis
DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More information1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below.
1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below. A-G-T-A-C-C-G-A-T A-G-T-G-A-T This type of alteration of the genetic information is an
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationWe have. Learned the structure of DNA. Talked about DNA replication and all of the complicated vocabulary that goes with it
Do Now 1. What enzyme inserts new DNA nucleotides during replication? 2. Name 2 other important players in DNA replication and their function. 3. In what direction can DNA polymerase add nucleotides? 4.
More informationGene Expression DNA to Protein - 1
Gene Expression DNA to Protein - 1 As we have just discussed, the structure of DNA provides a mechanism for selfreplication. The structure of DNA also reveals the mechanism for storing the genetic information
More informationUnit IIB Exam (v. 1.0)
Unit IIB Exam (v. 1.0) 1. The lac operon. (PT1-5) a. Is found only in eukaryotic cells b. Codes for the sequence of amino acids in lactase c. Regulates the transcription of mrna d. Regulates transcription
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationWhat does DNA stand for?
DNA and RNA What does DNA stand for? DNA = deoxribonucleic acid NOTE: the DNA from one cell would stretch 3 metre DNA are coiled and folded. DNA has two strands. What four bases are used in DNA? The four
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationTopic 10 Molecular Biology of the Gene
Topic 10 Molecular Biology of the Gene Sabotage Inside Our Cells Viruses are invaders that sabotage our cells Viruses have genetic material surrounded by a protein coat and, in some cases, a membranous
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationPre-AP Biology DNA and Biotechnology Study Guide #1
Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationREVISION: DNA, RNA & MEIOSIS 13 MARCH 2013
REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013 Lesson Description In this lesson we revise The structure and functions of DNA The structure of RNA and its role in protein synthesis The process of cell division
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More information(A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D) Is part of the eukaryote chromosome
Microbiology - Problem Drill 07: Microbial Genetics and Biotechnology No. 1 of 10 1. A plasmid is? (A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D)
More information