BEADLE & TATUM EXPERIMENT
|
|
- Joleen Esther Jennings
- 6 years ago
- Views:
Transcription
1 FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in DNA Transcribed to Produce RNA? How Is Eukaryotic DNA Transcribed and RNA Processed? How Is RNA Translated into Proteins? What Happens to Polypeptides after Translation? ONE GENE ONE ENZYME IDEA Phenotypic differences due to protein difference Garrod studied ALKAPTONURIA HA accumulated in blood due to an enzyme deficiency MODEL ORGANISMS TO STUDY Drosophila; E. coli; Neurospora crassa (common bread mold) BEADLE & TATUM EXPERIMENT one-gene, one-polypeptide relationship. The gene-enzyme relationship has since been revised to the Example: In hemoglobin, each polypeptide chain is specified by a separate gene. Other genes code for RNA are not translated to polypeptides; some genes are involved in controlling other genes. THE CENTRAL DOGMA The flow of information in cells DNA RNA PROTEINS REPLICATION Two steps in making proteins: Transcription Translation Remember RNA structure? THREE KINDS OF RNA Messenger RNA (mrna) carries copy of a DNA sequence to site of protein synthesis at the ribosome Transfer RNA (trna) carries amino acids for polypeptide assembly Ribosomal RNA (rrna) catalyzes peptide bonds and provides structure
2 FROM GENE TO PROTEIN Exception to the central dogma: retroviruses transcription We need: DNA template Nucleoside tri-phosphates (ATP, CTP, GTP, UTP) RNA polymerase RNA POLYMERASE TRANSCRIPTION OCCURS IN 3 PHASES INTITIATION ELONGATION TERMINATION INITIATION ELONGATION & TERMINATION THE GENETIC CODE Codon: A sequence of three bases each codon specifies a particular amino acid. Start codon: AUG initiation signal for translation. Stop codons: UAA, UAG, UGA stop translation and polypeptide is released. How was the code deciphered? 20 code words (amino acids) are written with only four letters. Triplet code seemed likely: Could account for = 64 codons. DECIPHERING THE GENETIC CODE THE GENETIC CODE Is REDUNDANT Not AMBIGUOUS Is UNIVERSAL Codons call for the same amino acids in all species Exception: Chloroplast and Mitochondrion DNA Genetic Code is the common language for evolution Has remained the same Facilitates genetic engineering DIFFERENCES BETWEEN PROKARYOTES & EUKARYOTES EUKARYOTIC GENES Promoters and terminators
3 Non-coding genes: Introns Coding sequences: Exons Introns and exons appear in the primary mrna transcript pre-mrna; introns are removed from the final mrna EUKARYOTIC GENES HOW INTRONS WERE DISCOVERED in Processing mrna In the nucleus, pre-mrna is modified at both ends: G cap is added at the 5 end (modified guanosine triphosphate) facilitates mrna binding to ribosome. G cap protects mrna from being digested by ribonucleases. Poly A tail added at 3 end. AAUAAA sequence after last codon is a signal for an enzyme to cut the pre-mrna; then another enzyme adds 100 to 300 adenines the tail. Adding the g-cap The snrnps (small nuclear ribonucleic particles) & SPLICEOSOME In the disease β-thalassemia, a mutation may occur at an intron consensus sequence in the β-globin gene the pre-mrna can not be spliced correctly. Non-functional β-globin mrna is produced. Messenger rna leaving the nucleus Through nuclear pores Led by TAP proteins attaching to 5 end Unused mrna stays in nucleus TRANSLATION Transfer RNA links information to the codons on m-rna Each t-rna brings the specific amino acid Transfer RNA must read codons correctly Transfer RNA must bring the correct amino acid to m-rna Three functions of trna: It binds to an amino acid, and is then charged It associates with mrna molecules It interacts with ribosomes Transfer rna 3 end is the amino acid attachment site binds covalently.
4 Anticodon: At the midpoint of the trna sequence site of base pairing with mrna. Unique for each species of trna. Wobble: Specificity for the base at the 3 end of the codon is not always observed. Example: Codons for alanine GCA, GCC, and GCU are recognized by the same trna. Wobble allows cells to produce fewer trna species, but does not allow the genetic code to be ambiguous CHARGING THE TRANSFER RNA MOLECULE RIBOSOMES Ribosomes have two subunits, large and small. In eukaryotes, the large subunit has three molecules of ribosomal RNA (rrna) and 49 different proteins in a precise pattern. The small subunit has one rrna and 33 proteins RIBOSOMES PARTS OF A RIBOSOME A (amino acid) site binds with anticodon of charged trna P (polypeptide) site is where trna adds its amino acid to the growing chain E (exit) site is where trna sits before being released from the ribosome Like transcription, translation also occurs in three steps: Initiation Elongation Termination INITIATION An initiation complex forms a charged trna and small ribosomal subunit, both bound to mrna. In prokaryotes rrna binds to mrna recognition site upstream from start codon. In eukaryotes the small subunit binds to the 5 cap on the mrna and moves until it reaches the start codon. INITIATION (start up codon on mrna is AUG) Elongation The second charged trna enters the A site.
5 Large subunit catalyzes two reactions: It breaks bond between trna in P site and its amino acid Peptide bond forms between that amino acid and the amino acid on trna in the A site ELONGATION Termination Translation ends when a stop codon enters the A site. Stop codon binds a protein release factor allows hydrolysis of bond between polypeptide chain and trna on the P site. Polypeptide chain separates from the ribosome C terminus is the last amino acid added. TERNMINATION POLYRIBOSOME OR POLYSOME POSTRANSLATIONAL ASPECTS Protein modifications Proteolysis: Cutting of a long polypeptide chain into final products, by proteases Glycosylation: Addition of sugars to form glycoproteins Phosphorylation: Addition of phosphate groups catalyzed by protein kinases charged phosphate groups change the conformation POSTRANSLATIONAL MODIFICATIONS TO PROTEINS
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationChapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationAP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationFrom RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationFrom Gene to Protein. Lesson 3
From Gene to Protein Lesson 3 Gregor Mendel Mendel hypothesized that certain factors were responsible for the traits that were inherited by pea plants Today, these factors are known as genes A sequence
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationTranslation BIT 220 Chapter 13
Translation BIT 220 Chapter 13 Making protein from mrna Most genes encode for proteins -some make RNA as end product Proteins -Monomer Amino Acid 20 amino acids -peptides -polypeptides -Structure of Amino
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationBiology. DNA & the Language of Life
Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationPROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationQ. No. 1. How can RNA be distinguished from DNA?
Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationGene Expression DNA to Protein - 1
Gene Expression DNA to Protein - 1 As we have just discussed, the structure of DNA provides a mechanism for selfreplication. The structure of DNA also reveals the mechanism for storing the genetic information
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 13 Protein Synthesis 2 3 4 5 6 7 8 9 10 Are You Getting It?? Which properties are characteristic of the normal genetic code? (multiple answers) a) A
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More information