Chapter 13. From DNA to Protein

Size: px
Start display at page:

Download "Chapter 13. From DNA to Protein"

Transcription

1 Chapter 13 From DNA to Protein

2 Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene

3 The Path From Genes to Proteins 1. Transcription Enzymes use the base sequence of a gene as a template to make a strand of RNA 2. Translation Information in the RNA strand is decoded (translated) into a sequence of amino acids transcription translation DNA RNA Protein

4 Prokaryotes and Eukaryotes In prokaryotic cells (no nucleus) Transcription and translation occur in cytoplasm In eukaryotic cells Genes are transcribed in the nucleus Resulting mrna is translated in the cytoplasm

5 Key Concepts: INTRODUCTION Life depends on enzymes and other proteins All proteins consist of polypeptide chains Chains are sequences of amino acids that correspond to sequences of nucleotide bases in DNA called genes The path leading from genes to proteins has two steps: transcription and translation

6 Transcription: DNA to RNA Two DNAstrands unwind in a specific region RNA polymeraseassembles a strand of RNA Covalently bonds RNA nucleotides (adenine, guanine, cytosine, uracil) according to the nucleotide sequence of the exposed gene

7 Three Types of RNA Messenger RNA (mrna) Carries protein-building codes from DNA to ribosomes Ribosomal RNA (rrna) Forms ribosomes (where polypeptide chains are assembled) Transfer RNA (trna) Delivers amino acids to ribosomes

8 RNA and DNA Compared

9 RNA Base Pairing

10 phosphate group base (uracil) sugar (ribose)

11

12

13 gene region newly forming RNA transcript RNA polymerase, the enzyme that catalyzes transcription DNA template winding up DNA template unwinding Fig. 13.3, p.198

14 Fig. 13.3, p.198

15

16 RNA Modification: Alternative Splicing Before mrna leaves the nucleus: Intronsare removed Some exonsare removed along with introns; remaining exons are spliced together in different combinations Poly-A tailis added to 3 end of new mrna

17 The Poly-A Tail The longer its poly-a tail, the more time an mrna transcript (and its protein-building message) will remain intact in the cytoplasm

18 unit of transcription in DNA strand exon intron exon intron exon transcription into pre-mrna cap poly-a tail 5' 3' snipped out snipped out mature mrna transcript

19 Key Concepts: TRANSCRIPTION During transcription, the two strands of the DNA double helix are unwound in a gene region Exposed bases of one strand become the template for assembling a single strand of RNA (a transcript) Messenger RNA is the only type of RNA that carries DNA s protein-building instructions

20 The Genetic Code Messenger RNA(mRNA) carries DNA s protein-building information to ribosomes for translation mrna s genetic message is written in codons Sets of three nucleotides along mrna strand

21 Codons Codons specify different amino acids A few codon signals stop translation Sixty-four codons constitute a highly conserved genetic code

22 From DNA to Polypeptide

23 Variation in Genetic Code Variant codons occur among prokaryotes, prokaryote-derived organelles (such as mitochondria), and some ancient lineages of single-celled eukaryotes

24 Key Concepts: CODE WORDS IN THE TRANSCRIPTS The nucleotide sequence in RNA is read three bases at a time Sixty-four base triplets that correspond to specific amino acids represent the genetic code, which has been highly conserved over time

25 trna and rrna Function in Translation Transfer RNA (trna) Anticodon binds to mrna codon Also binds amino acid specified by codon Different trnas carry different amino acids trnas deliver free amino acids to ribosomes during protein synthesis

26 trna

27 rrna Ribosomal RNA (rrna)and proteins make up the two subunits of ribosomes

28 SUMMARY: Protein Synthesis

29 Three Stages of Translation mrna-transcript information directs synthesis of a polypeptide chain during translation Translation proceeds in three stages Initiation Elongation Termination

30 Initiation One initiator trna, two ribosomal subunits, and one mrna come together as an initiation complex

31 Initiation

32 Elongation trnas deliver amino acids to the ribosome in the order specified by mrna codons Ribosomal rrna catalyzes the formation of a peptide bond between amino acids

33 Elongation

34 Elongation

35 Elongation

36 Termination Translation ends when RNA polymerase encounters a STOP codon in mrna New polypeptide chain and mrna are released Ribosome subunits separate from each other

37 Termination

38 Key Concepts: TRANSLATION During translation, amino acids become bonded together into a polypeptide chain in a sequence specified by base triplets in messenger RNA Transfer RNAs deliver amino acids one at a time to ribosomes Ribosomal RNA catalyzes the formation of peptide bonds between the amino acids

39 Mutated Genes and Their Protein Products Mutationsare permanent, small-scale changes in the base sequence of a gene Common mutations include insertions, deletions, and base-pair substitutions

40 Common Gene Mutations

41 Transposable Elements Another type of insertion mutation is caused by the activity of transposable elements Segments of DNA that can insert themselves anywhere in a chromosome

42 Some Causes of Mutations Natural and synthetic chemicals Cigarette smoke Environmental agents Ionizing radiation Nonionizing radiation

43 Key Concepts: MUTATIONS IN THE CODE WORDS Mutations in genes may result in changes in protein structure, protein function, or both The changes may lead to variation in traits among individuals

44

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

UNIT 3 GENETICS LESSON #41: Transcription

UNIT 3 GENETICS LESSON #41: Transcription UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA

More information

How to Use This Presentation

How to Use This Presentation How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator' Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928 HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

Sections 12.3, 13.1, 13.2

Sections 12.3, 13.1, 13.2 Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

PROTEIN SYNTHESIS. Higher Level

PROTEIN SYNTHESIS. Higher Level PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Section 3: DNA Replication

Section 3: DNA Replication Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013

REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013 REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013 Lesson Description In this lesson we revise The structure and functions of DNA The structure of RNA and its role in protein synthesis The process of cell division

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Q. No. 1. How can RNA be distinguished from DNA?

Q. No. 1. How can RNA be distinguished from DNA? Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information? DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson: BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles

More information