Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
|
|
- Tiffany Cunningham
- 6 years ago
- Views:
Transcription
1 Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC CTT CTG CGC GGC TGG GGT GCC CGG TGG-3 for NDRG4, /5AmMC6/GCG GGA CAC TCC GAA GGC GCA AGG AG-3 for BMP3, /5AmMC6/CGC CTG GAG CAG AAA GCC GCG CAC CT-3 for TFPI2, /5AmMC6/CCT TGT CAC ACG AGC CAG TGT TAG TAC CTA CAC C-3 for ACTB, /5AmMC6/GGC CTG CTG AAA ATG ACT GAA TAT AAA CTT GTG GTA GTT GGA GC-3 and /5AmMC6/CTC TAT TGT TGG ATC ATA TTC GTC CAC AAA ATG ATT CTG AAT TAG C-3 for KRAS (IDT, Coralville IA). Supplement 2: QuARTS Reaction. QuARTS (quantitative allele-specific real-time target and signal amplification) technology was used to quantify methylated gene markers, the reference gene β-actin, and KRAS mutations (see illustration below). There are three reactions sequentially occurring in each QuARTS assay, including DNA amplification (reaction 1) and target probe cleavage (reaction 2) in primary reaction and FRET cleavage and fluorescent signal generation (reaction 3) in secondary reaction. When target DNA is being amplified with specific primers, specific detection probe with a flap sequence loosely binds to the amplicon. With the presence of a specific invasive oligo at the target binding site, cleavase releases the flap sequence by cutting between detection probe and flap sequence. The flap sequence is complementary to the non-hairpin part of corresponding FRET. The flap sequence functions as an invasive oligo on corresponding FRET and ignites the
2 cleavage between fluorophore and quencher to release fluorescent signal. The cleavage reaction can cut multiple probes per target and multiple FRET cassettes per flap giving exponential signal amplification to the overall assay. QuARTS can detect multiple targets in a single reaction well by using FRETS with different dyes. Supplement 3: Methylation Assays. We treated 45 µl captured DNA with bisulfite using EZ-96 DNA Methylation Kit according to manufacturer s instructions (Zymo Research, Irvine CA) and eluted the sample in 50 µl of Zymo M-dilution buffer with 20 ng/µl trna (Sigma) on a 96-well PCR plate; 10 µl of bisulfite treated DNA was added to the QuARTS assays, which were set up in 30 µl total reaction volumes on a 96-well PCR plates. PCR plates were cycled in a LightCycler 480 (Roche). Two separate triplex QuARTS assays were designed to detect methylated markers vimentin, NDRG4, BMP3, and TFPI2 using ACTB as a reference gene for each assay. The first triplex assay contained ACTB, vimentin, and NDRG4, and the second contained ACTB, BMP3, and TFPI2. Each QuARTS reaction incorporated
3 nm primers and detection probes, 100 nm invasive oligo, nm each of FAM (Hologic, Madison WI), Yellow (Hologic), and Quasar 670 (BioSearch Technologies, Novato CA) fluorescence resonance energy transfer reporter cassettes (FRETs), ng/µl Cleavase 2.0 (Hologic), 1 unit hot-start GoTaq DNA polymerase (Promega, Madison WI), 10 mm MOPS, 7.5 mm MgCl 2, and 250 µm of deoxyribonucleotide triphosphate (dntp). QuARTS cycling conditions consisted of 95 ºC 3 min, 10 cycles at 95 ºC 20 sec, 67 ºC 30 sec, and 70 ºC 30 sec, 45 cycles at 95 ºC 20 sec, 53 ºC 1 min, and 70 ºC 30 sec, and 40 ºC hold 30 sec. Methylation-specific primers and probe were 5 -GGC GGT TCG GGT ATC G-3, 5 -CGT AAT CAC GTA ACT CCG AC T-3, and 5 -GAC GCG GAG GCG AGT CGG TCG/3 C6/ for vimentin; 5 - CGG TTT TCG TTC GTT TTT TCG-3, 5 -GTA ACT TCC GCC TTC TAC GC-3, and 5 -CGC CGA GGG TTC GTT TAT CG/3 C6/ for NDRG4; 5 -GTT TAA TTT TCG GTT TCG TCG TC-3, 5 -CTC CCG ACG TCG CTA CG-3, 5 -CGC CGA GGC GGT TTT TTG CG/3 C6/ for BMP3; and 5 -TCG TTG GGT AAG GCG TTC-3, 5 -AAA CGA ACA CCC GAA CCG-3, 5 -GAC GCG GAG GCG GTT TTT TGT T/3 C6/ for TFPI2. TFPI2 assay had a specific invasive oligo 5 GCG GGA GGA GGT GCC-3. Primers and probe for detecting bisulfite-treated ACTB were 5 -TTT GTT TTT TTG ATT AGG TGT TTA AGA-3, 5 -CAC CAA CCT CAT AAC CTT ATC-3, and 5 - CCA CGG ACG ATA GTG TTG TGG/3 C6/. Each plate included bisulfite-treated DNA samples, standard curve samples, positive and negative controls, and water blanks. Standard curves were made using 300 to 1000 target sequences cut from engineered plasmids. Bisulfite-treated sheared CpGenomeTM universal methylated DNA (Zymo Research) and human genomic DNA
4 (ATCC, Manassas, VA) were used as positive and negative controls. DNA strand number was determined by comparing a predetermined crossing threshold of the target gene to the standard curve of that assay. Percent methylation for each marker was determined by dividing the strand number of the methylated gene by the ACTB strand number and multiplied by 100. Supplement 4: KRAS Mutation Assays. KRAS gene was first PCR amplified with primers flanking codons 12/13 using 10 µl of captured KRAS DNA as template. PCR was conducted with U/µl hot start GoTaq and 200 nm each primers in a 100 µl reaction volume at 95ºC 3 min, and 15 cycles at 95ºC 20 sec, 62ºC 30 sec, and 72ºC 30 sec. Primer sequences were 5 -AGG CCT GCT GAA AAT GAC TG-3 and 5 -CTA TTG TTG GAT CAT ATT CG TC-3. Each amplified sample was diluted 500-fold in nuclease free water. 10 µl of the 500-fold sample dilutions was added to 96-well PCR plate with an automated liquid handler epmotion (Eppendorf, Hauppauge NY). QuARTS assays were then used to evaluate seven mutations at codons 12/13 of the KRAS gene. Mutation-specific forward primers and probes were 5 -CTT GTG GTA GTT GGA GCA A-3 and 5 -GCG CGT CCA GTG GCG TAG GC/3 C6/ for KRAS G12S mutation; 5 -AAA CTT GTG GTA GTT GGA CCT T-3 and 5 -GCG CGT CCT GTG GCG TAG GC/3 C6/ for G12C mutation; 5 - TAT AAA CTT GTG GTA GTT GGA CCT C-3 and 5 -GCG CGT CCC GTG GCG TAG GC/3 C6/ for G12R mutation; 5 -ACT TGT GGT AGT TGG AGC TCA-3 and 5 - GCG CGT CCA TGG CGT AGG CA/3 C6/ for G12D mutation; 5 -ACT TGT GGT AGT TGG AGC TCT-3 and 5 -GCG CGT CCT TGG CGT AGG CA/3 C6/ for G12V
5 mutation; 5 -AAC TTG TGG TAG TTG GAG ATG C-3 and 5 -GCG CGT CCC TGG CGT AGG CA/3 C6/ for G12A mutation; 5 -GGT AGT TGG AGC TGG TCA-3 and 5 - GCG CGT CCA CGT AGG CAA GA/3 C6/ for G13D mutation. The reverse primer for each was 5 -CTA TTG TTG GAT CAT ATT CGT C-3. Each mutation assay was designed as a singleplex assay. QuARTS cycling conditions and reagent concentrations for KRAS were the same as those in the methylation assays. Each plate contained standards made of engineered plasmids, positive and negative controls, and water blanks, and was run in a LightCycler 480 (Roche). DNA strand number was determined by comparing a predetermined crossing threshold of the target gene to the standard curve for that assay. The concentration of each KRAS mutation marker in 50 µl was calculated based on the 500-fold dilution factor and an amplification efficiency of This value was divided by the ACTB concentration in the methylation assay, and then multiplied by 100 to determine the percent mutation.
6 Supplement 5: Logistical Regression Model
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationNESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationWet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationSUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
More informationTable S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More informationThe B1 Protein Guides the Biosynthesis of a Lasso Peptide
The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationAmplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires
Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner*
More informationSupplemental Data. Jones et al. Plant Cell. (2010) /tpc
IAA synthesis rate Supplemental Data. Jones et al. Plant Cell. ()..5/tpc..7856 Supplemental Figure. Root tip specific IAA biosynthesis after induction of the CKX gene. 6 DAG pmdc7:atckx seedling roots
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table S1: Water sampling sites in Brisbane River and their characteristics Sampling sites GPS coordinates Site characteristics Suspected source of fecal pollution
More informationDNA Computing Circuits Using Libraries of. DNAzyme Subunits
SUPPLEMENTARY INFORMATION Supplementary Information for the paper: DNA Computing Circuits Using Libraries of DNAzyme Subunits Johann Elbaz a, Oleg lioubashevski a, Fuan Wang a, Françoise Remacle b, Raphael
More informationSupplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More informationAppendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A
Supplementary information Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their double drug resistant progeny (ABI 377). Primer set a,b Amplified cdna (base pairs) P1-hyg P2-neo All progeny
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationChapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
More information-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and
Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Coding and noncoding transcription at the vg locus. (a,b) qpcr analysis of developmental and tissue-specific vg mrna (a) and PRE/TRE (b) transcription, shown as percentage of TBP
More informationSupplementary Material and Methods
Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold
More informationSupplementary Information
Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.
More informationA Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationYeast BioBrick Assembly (YBA)
Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg
More informationSupplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.
arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein
More informationEfficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit
Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Mariko Suzuki 1, Saki Kondo 1, Manabu Yamasaki 2, Norie Matsuda 2, Akio Nomoto 2, Tetsuro
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationPhosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease
Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,
More informationProtocol Rf3 Community Reference Laboratory for GM Food and Feed
EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification
More information