Goals of pharmacogenomics

Size: px
Start display at page:

Download "Goals of pharmacogenomics"

Transcription

1 Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion of the degradation products 100,000 deaths and 2.2 million adverse reactions reported each year 1

2 2 Dosage and drug specific to individual Get it right the first time Create individual metabolic profile Screening presymptomatic testing carriers preimplantation, prenatal, newborn screening disease susceptibility

3 DNA polymorphisms People differ in nucleotide sequence Coding sequences Non-coding sequences (most differences) Differences can be used as DNA markers Evolution To identify individuals To diagnose disease To diagnose genetic predisposition to disease 3

4 SNPs = Single nucleotide polymorphisms (handout and CH 8 pg 270) DNA sequence variations that occur when a single nucleotide in the genome sequence is altered Occur ~1/300 bases in human genome Make up ~ 90% of all human genetic variation Effort underway to map all human SNPs (~3 million) What is the size of the human genome in base pairs?

5 Many SNPs have no effect on cell function Non-coding region? Coding region? Others could: cause disease influence disease progression predispose to disease influence response to a drug 5

6 Mutation analysis of genes that control the G1/S cell cycle in melanoma: TP53, CDKN1A, CDKN2A, and CDKN2B José Luis Soto 1, Carmen M Cabrera 1, Salvio Serrano 2 and Miguel Ángel López-Nevot 1 analyzed 39 primary and metastatic melanomas and 9 melanoma cell lines C to T base change (intron1 of TP53 gene) compared with control. read a sequencing gel 6

7 7 Fig open angle glaucoma (most common form, leading form of blindness in US)

8 SNP Read the gel results 8

9 Tumor gene Find the SNP

10 Example: Alcohol dehydrogenase SNPs Some SNPS in ALDH gene associated with extreme sensitivity to small doses of alcohol tachycardia, vomiting 13 SNPs found in human population 10

11 DNA Microarrays pg. 239, SARS handout Microarrays =small, glass slide (usually) spotted with short sequences from ~20,000 different genes at fixed locations oligonucleotides ~20 bases single stranded 11

12 Skin cancer microarray animation 1. Obtain sample phelgm, blood, tissue, tumor 2,3. Isolate mrna Expressed genes only Quantitative 4. Reverse transcribe mrna to cdna cdna more stable than mrna Fluorescently labeled nucleotides used 12

13 5. Coat microarray chip with tagged cdnas Hybridization - Immobilized target oligos found by probe DNA (the cdnas) and nucleotides hybridize Transcriptic microarray (vs. genomic)

14 14 6. Scan for fluorescence

15 15

16 Transcriptional response in the peripheral blood of patients infected with Salmonella enterica serovar Typhi. Thompson LJ, et al Microarrays of peripheral blood to investigate host response of 29 individuals who contracted typhoid fever in Mekong Delta, Vietnam. Samples taken over a 9 month period encompassing acute disease, convalescence, and recovery. Typhoid fever induced a distinct and highly reproducible microarray pattern in the blood that changed during treatment and convalescence, returning in the majority of cases to the "normal" profile in healthy uninfected controls. Unexpectedly, there was a microarray pattern present at day 9 after infection that remained unchanged one month after infection and in some persisted as long as nine months despite a complete clinical recovery in all patients. Patients who retain the convalescent microarray pattern may be genetically or temporarily incapable of developing an effective immune response and may be more susceptible to reinfection, relapse, or the establishment of a carrier state. 16

17 The future (and present) Transcriptome Collection of all RNA transcripts in the cell (m, t, rrna) Tissue specific gene expression Which genes are on/off 17

18 Metabolome All the small molecules involved in metabolic pathways 3000 common metabolites in body tissues and biofluids People react differently to nutritional input, drugs 18

19 Proteome All proteins in the cell Larger than the genome Alternative splicing Post translational modification Different proteins are found in different cells 19

20 Microbiome Human gut and how it changes with disease 10X more bacteria in/on human body than human cells 20

21 species in oral cavity (most uncultivated, unnamed!) Over 1000 species in human gut Influence development, breakdown and absorption of nutrients, immunity, physiology Study microbes as community

22 Gnotobiotic mouse models born, removed from the mother by C-section in sterile environment Can be humanized 22

23 Genetic predisposition example: Alzheimer's disease SNPs ApoE gene 3 alleles E2, E3, and E4 each with a unique SNP GENETIC PREDISPOSITION AND RISK The E genes are susceptibility gene 23

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Human Genomics. 1 P a g e

Human Genomics. 1 P a g e Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3

More information

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health

Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Unit 8: Genomics Guided Reading Questions (150 pts total)

Unit 8: Genomics Guided Reading Questions (150 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided

More information

Methods for Working with DNA and RNA

Methods for Working with DNA and RNA Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are

More information

Genomes: What we know and what we don t know

Genomes: What we know and what we don t know Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Complete draft sequence 2001

Complete draft sequence 2001 Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms

More information

SGN-6106 Computational Systems Biology I

SGN-6106 Computational Systems Biology I SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th

More information

By the name of ALLA. To calculate the statistical significance we use certain formula to know the significance of certain mutation.

By the name of ALLA. To calculate the statistical significance we use certain formula to know the significance of certain mutation. By the name of ALLA LECTURE NO# 13 This lecture include the slide from 43 to 74 so plz refer to them Genome-wide association studies (GWAS) : GWAS is the study of whole genome of the Pts to find mutation

More information

Finding Genes with Genomics Technologies

Finding Genes with Genomics Technologies PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

Moc/Bio and Nano/Micro Lee and Stowell

Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Chapter 8 Healthcare Biotechnology

Chapter 8 Healthcare Biotechnology Chapter 8 Healthcare Biotechnology Outline: 8.1 Introduction 8.2 Biopharming 8.3 Models of Human Disease 8.4 Detecting and Diagnosing Human Disease 8.5 Monoclonal Antibodies 8.6 Gene Therapy 8.7 Tissue

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

II. Integrative Genomics interactions between molecules and genes

II. Integrative Genomics interactions between molecules and genes . Structural Genomics Structure of Genome I. Functional Genomics Expression of Genome a. Transcriptomics b. Proteomics II. Integrative Genomics interactions between molecules and genes Fields of Genomics

More information

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future.

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular

More information

-Is the process of manipulating genes and genomes

-Is the process of manipulating genes and genomes Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes

More information

I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics. a. Transcriptomics b. Proteomics

I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics. a. Transcriptomics b. Proteomics I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics a. Transcriptomics b. Proteomics Fields of Genomics Structural genomics Functional genomics Transcriptomics Proteomics

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms,

Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms, Gene Structure-Introns, Exons and Pseudogenes... What is a gene? Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms, is a nucleotide sequence necessary for the synthesis

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

NGS to address ncrna and viruses

NGS to address ncrna and viruses NGS to address ncrna and viruses Introduction & TRON Next generation sequencing transcriptomics ncrnas vrna June 30, 2010 John Castle Institute for Translational Oncology and Immunology (TRON) Mainz, Germany

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Achievement Level Descriptors for Medical Interventions

Achievement Level Descriptors for Medical Interventions Achievement Level Descriptors for Medical Interventions Achievement Level Descriptors (ALDs) are statements of what students should know and be able to do in a PLTW classroom. The ALDs can be used to better

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health 3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis

More information

Introduction to human genomics and genome informatics

Introduction to human genomics and genome informatics Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer

More information

Genetic Basis of Development & Biotechnologies

Genetic Basis of Development & Biotechnologies Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive

More information

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009 MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Lecture 11 Microarrays and Expression Data

Lecture 11 Microarrays and Expression Data Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 11 Microarrays and Expression Data Genetic Expression Data Microarray experiments Applications Expression

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

DNA Technology and Genomics

DNA Technology and Genomics DNA Technology and Genomics I. DNA cloning permits production of many copies of a specific gene or other DNA segment. A. To study a particular gene, scientists needed to develop methods to isolate the

More information

Chapter 12. DNA Technology. Lectures by Edward J. Zalisko

Chapter 12. DNA Technology. Lectures by Edward J. Zalisko Chapter 12 DNA Technology PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane B. Reece

More information

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique

More information

Therapeutic & Prevention Application of Nucleic Acids

Therapeutic & Prevention Application of Nucleic Acids Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Trend in diagnostic biochip. Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital

Trend in diagnostic biochip. Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital Trend in diagnostic biochip development Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital Handling of the early stage is important for

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

Genetics of Plant-Pathogen Interactions (Plant Immunity) Topics on Systemic Acquired Resistance (SAR)

Genetics of Plant-Pathogen Interactions (Plant Immunity) Topics on Systemic Acquired Resistance (SAR) Genetics of Plant-Pathogen Interactions (Plant Immunity) Topics on Systemic Acquired Resistance (SAR) Major types of plant pathogens - Bacteria - Fungi (>80% loss) - Viruses - Viroid Can you name a few

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

University of Athens - Medical School. pmedgr. The Greek Research Infrastructure for Personalized Medicine

University of Athens - Medical School. pmedgr. The Greek Research Infrastructure for Personalized Medicine University of Athens - Medical School pmedgr The Greek Research Infrastructure for Personalized Medicine - George Kollias - Professor of Experimental Physiology, Medical School, University of Athens President

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information