Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires
|
|
- Edwin Jacobs
- 6 years ago
- Views:
Transcription
1 Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner* Institute of Chemistry, The Hebrew University of Jerusalem, Jerusalem 91904, Israel Experimental Section: Materials. 4-(2-hydroxyethyl)piperazine-1 ethanesulfonic acid sodium salt (HEPES), sodium chloride and Magnesium chloride were purchased from Sigma-Aldrich. All oligonucleotide sequences were purchased from Integrated DNA Technologies Inc. (Coralville, IA). All DNA primers were HPLC-purified and freeze-dried by the company. They were used as provided and diluted in 10 mm phosphate Buffer (PB) to give stock solution of 100 μm. Table S1 depicts the sequences of the oligonucleotides used in the study. Ultrapure water from a NANOpure Diamond (Barnstead) source was used in all of the experiments. S1
2 Table S1 The DNA sequences used to construct the detection platform Number Sequence (1) 5 TC AAT TAG A AAG CAC CCA TGT TAC TCT3 (2) 5 GAT ATC AGC GAT CTT AG TCT TATG 3 (3) 5 Black Hole Quencher-1-AGA GTA TrAG GAT ATC-FAM 3 (4) 5 CATA AGA CTT CTA ATT GA 3 (5) (6) (7) (8) (9) 5 GAT ATC AGC GAT CTT CTA ATT GA AAG TTAT TAA TC AAT TAG AAG TCT TATG AAG CAC CCA TGT TAC TCT 3 5 GAT ATC AGC GAT CTT TTA ATAA CTT TC AAT TAG CATA AGA CTT CTA ATT GA AAG CAC CCA TGT TAC TCT 3 5 TC AAT TAG AAG CAA AAT TAT TTA TGA AGC TGT ATG GTT TCA GCA ACA GGG AGC AA CATA AGA CTT CTA ATT GA 3 5 TT GCT CCC TG T TGC TGA AAC CAT ACA GCT TCA TAA ATA ATT TTG CTT 3 5 CTT TTA ATAA CTT TC AAT TAG CATA AGA CTT CTA ATT GA AAG 3 Instrumentation: Light emission measurements were performed using a Cary Eclipse spectrometer (Varian inc). The FAM was excited at 495 nm. Fluorescence emission spectra were recorded from 500 to 600 nm. Atomic force microscopy (AFM) images were recorded using a Nanoscope 3A controller (Digital Instruments/Veeco Probes/USA) with NSC 15 AFM tips (Mikromasch, Germany) using the tapping mode at their resonant frequency. 10 μl of MgCl 2 (5mM) were deposited on freshly cleaved mica surface (Structure Probe Inc., USA) for 2 min, followed by their rinsing with double distilled water (DDW) and drying under a stream of nitrogen. The DNA sample was deposited on the mica surface, dried in air and gently washed with DDW. Images were analyzed using the WsXM SPIP software (Nanotec, Inc., Spain). S2
3 Experimental section: All the assays were prepared in 10 mm HEPES buffer containing 1 M NaCl and 20 mm MgCl 2. Each functional hairpin structure (1 μm) was heated to 95 C for 5 min and then allowed to cool to room temperature (25 C) for at least 2 hours before use. Then, different concentrations of the target DNA (4) were incubated with 0.5 μm of the prepared hairpin for 6 hours. Subsequently, the ribonucleobase (ra) containing substrate (3, 0.5 μm) was added to the sample and the time-dependent fluorescence changes upon analyzing different concentrations of target DNA (4) were monitored spectroscopically at 25 C. For the analysis of the target DNA (4) by using the Mg 2+ -dependent DNAzyme subunits, the concentration of the ribonucleobase (ra) containing substrate (3), and both DNAzyme subunits (1 and 2) were 0.5 μm. For AFM characterization of the DNA wires that were produced by cross-opening of the functional DNA hairpin structures (5 and 6), the concentration of both hairpins was 0.5 μm and the analyte DNA (4) was 10 nm. For the analysis of BRCA1 oncogene (8), the concentration of helper probe hairpin (7) was 0.3 μm, and the concentration of each of the Mg 2+ -dependent DNAzyme functionalized hairpins (5) and (6) was 0.5 μm. S3
4 Figure S1. Time-dependent fluorescence changes upon sensing different concentrations of the target analyte DNA, according to the Scheme shown in Figure 1(A): (a) 0 M, (b) 1 x 10-9 M, (c) 1 x 10-8 M and (d) 1 x 10-7 M. S4
5 The amplified analytical platform has an intermediate phase where one set of Mg 2+ -dependent DNAzyme subunit (I and I ) was removed from the functional hairpin (6). The analyte (4) opens hairpin (5) to yield structure a. The resulting structure opens hairpin (9) through a strand displacement process and yields structure b. The later structure opens hairpin (5) to yield structure c that includes the adjacent subunits of the Mg 2+ -dependent DNAzyme or active DNAzyme. By the repeated steps 2 and 3, the one-sided polymers consisting of the Mg 2+ -dependent DNAzyme subunits are formed, Figure S2(A). The time dependent fluorescence changes upon analyzing different concentrations of the target (4) are shown in Figure S2(B). The resulting calibration curve is shown in Figure S2(B), inset. The autonomous cross-opening of the hairpins (5) and (9) results in the amplified detection of the target (4). The sensitivity (1 x M) and the resulting fluorescence intensities generated by the one-sided DNAzyme wires is, however, lower than the results obtained with the two-sided DNAzyme polymer wires. S5
6 Figure S2. (A) Amplified analysis of the target DNA (4) using two functional hairpins that upon the recognition of the target by (5) initiate an autonomous cross-opening of the hairpin structures (5 and 9) that lead to the formation of polymer wires consisting of one-sided Mg 2+ -dependent DNAzyme units, that lead to the cleavage of the substrate (3) and the generation of fluorescence. (B) Time-dependent fluorescence changes upon analyzing different concentrations of (4), according to the Scheme outlined in Figure S1(A): (a) 0 M, (b) 1 x M, (c) 1 x M, (d) 1 x M, (e) 1 x M, (f) 1 x 10-9 M, (g) 1 x 10-8 M, (h) 1 x 10-7 M. Inset: Resulting calibration curve. S6
7 Selectivity of analyzing the target DNA (4). Figure S3 demonstrates the selective analysis of the target (4) by the hairpins (5) and (6) by showing the performance of the system towards the discrimination of one base-, two baseand three-base mutations ((4a), (4b) and (4c)). For the detailed sequences of the mutants, see Table S2. Table S2 The DNA analyte with different base mutations Number Sequence (4a) 5 CATA AGA CTT GTA ATT GA 3 (4b) 5 CATA ACA CTT GTA ATT GA 3 (4c) 5 CATA ACA CTT GTA ATT CA 3 Figure S3: Time-dependent fluorescence changes upon analyzing the target DNA (4) and its mutants ((4a), (4b) and (4c)), 1 x 10-9 M, according to the platform shown in Figure 1(B): (a) the target (4), (b) one-base mutation (4a), (c) two-base mutations (4b) and (d) three-base mutations (4c). All systems consist of (5), 0.5 μm and (6) 0.5 μm in the presence of the respective analytes. S7
8 Optimization of the strands (5) and (6) for the sensing platform shown in Figure 1(B). For the effective development of the sensing platform shown in Figure 1(B) one should design the hairpins (5) and (6) to exhibit the following properties: (i) the hairpins (5) and (6) should be retained in fully closed structure prior to the interaction with the analyte (4) to eliminate cross-opening and a background signal. (ii) The hairpins (5) and (6) should exhibit a limited stabilizing energy to enable opening of (5) by the analyte and effective cross-opening process. Table S3 shows the respective sequences used to optimize the hairpin structures. Figure S4 shows the analysis of the respective targets, 100 nm, by the hairpins (5i)/(6i), (5)/(6), (5ii)/(6ii), (curves (a), (b) and (c)) and the performance of the systems in the absence of the analyte (curves (a ), (b ) and (c )). One may realize that only the (5)/(6) systems show high performance signals in the presence of the analyte and zero fluorescence in the absence of the analyte. Table S3 DNA sequences used to optimize the detection platform Number Sequence (4i) 5 C CATA AGA CTT CTA ATT G 3 (5i) 5 GAT ATC AGC GAT CTT CTA ATT G AAG TTTAT TAA C AAT TAG AAG TCT TATGG AAG CAC CCA TGT TAC TCT 3 (6i) 5 GAT ATC AGC GAT CTT TTA ATAAA CTT C AAT TAG CCATA AGA CTT CTA ATT G AAG CAC CCA TGT TAC TCT 3 (4) 5 CATA AGA CTT CTA ATT GA 3 (5) (6) 5 GAT ATC AGC GAT CTT CTA ATT GA AAG TTAT TAA TC AAT TAG AAG TCT TATG AAG CAC CCA TGT TAC TCT 3 5 GAT ATC AGC GAT CTT TTA ATAA CTT TC AAT TAG CATA AGA CTT CTA ATT GA AAG CAC CCA TGT TAC TCT 3 (4ii) 5 CAA AGA CTT CTA GTT GCG 3 (5ii) (6ii) 5 GAT ATC AGC GAT CTT CTA GTT GCG AAG GGT TAA CGC AAC TAG AAG TCT TTG AAG CAC CCA TGT TAC TCT 3 5 GAT ATC AGC GAT CTT TTA ACC CTT CGC AAC TAG CAA AGA CTT CTA GTT GCG AAG CAC CCA TGT TAC TCT 3 S8
9 Figure S4: (A) Time-dependent fluorescence changes of the amplified detection platform shown in Figure 1B using different hairpins that include different composition of the stem regions in the hairpins: (a ) and (a) hairpins (5i) and (6i) containing 10 base pairs in the stem regions, in the absence or presence of target (4i) (100 nm), respectively; (b ) and (b) hairpins (5) and (6) containing 11 base pairs in the stem regions, in the absence or presence of target (4) (100 nm), respectively; (c ) and (c) hairpins (5ii) and (6ii) containing 12 base pairs in the stem regions, in the absence or presence of target (4ii) (100 nm), respectively. S9
DNA Computing Circuits Using Libraries of. DNAzyme Subunits
SUPPLEMENTARY INFORMATION Supplementary Information for the paper: DNA Computing Circuits Using Libraries of DNAzyme Subunits Johann Elbaz a, Oleg lioubashevski a, Fuan Wang a, Françoise Remacle b, Raphael
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationSurface modification of a DNA tetrahedron
Surface modification of a DNA tetrahedron Chuan Zhang, Min Su, Yu He, Yujun Leng, Alexander E. Ribbe, Guansong Wang ±, Wen Jiang & Chengde Mao * Department of Chemistry, Markey Center for Structural Biology
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationSupporting Information
Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Site-Specific Control of Distances between Gold Nanoparticles using Phosphorothioate Anchors on DNA and a Short Bifunctional Molecular Fastener
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationAn enzyme-free DNA walker that moves on the surface of. functionalized magnetic microparticles and its biosensing analysis
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationApplication of DNA machine in amplified DNA detection
Electronic Supplementary Information Application of DNA machine in amplified DNA detection Hailong Li, Jiangtao Ren, Yaqing Liu,* and Erkang Wang* State Key Lab of Electroanalytical Chemistry, Changchun
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationDNA Tetrahedron-Based Molecular Beacon for Tumor-Related
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information (ESI) DNA Tetrahedron-Based Molecular Beacon for Tumor-Related
More informationSUPPLEMENTARY INFORMATION
1. RNA/DNA sequences used in this study 2. Height and stiffness measurements on hybridized molecules 3. Stiffness maps at varying concentrations of target DNA 4. Stiffness measurements on RNA/DNA hybrids.
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationA high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for
Supporting Information for A high efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of microrna in cancer cells Zhaoyang
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationConstruction of an Autonomously Concatenated Hybridization Chain Reaction for Signal Amplification and Intracellular Imaging
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Supporting Information Construction of an Autonomously Concatenated Hybridization Chain
More informationWet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
More informationA netlike rolling circle nucleic acid amplification technique
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationUniversal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting materials Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationEvent-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR. Validated Method
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationCharacterization of deoxyribozymes with site-specific oxidative. cleavage activity against DNA obtained by in vitro selection
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Characterization of deoxyribozymes with site-specific oxidative cleavage
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationSupporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationNESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationSupporting Information
Supporting Information CLOSTRIDIOLYSIN S: A POST-TRANSLATIONALLY MODIFIED BIOTOXIN FROM CLOSTRIDIUM BOTULINUM David J. Gonzalez 1, Shaun W. Lee 9, Mary E. Hensler 6, Andrew L. Markley 1, Samira Dahesh
More informationSupplementary Information
Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationSequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps
Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*
More informationPhosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease
Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,
More informationDetection and quantification of bovine polyomavirus by real-time PCR
Page 1 of 5 EU FP VII PROJECT VITAL STANDARD OPERATING CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 18-02-2010 FERA: 28-03-2010 Wim Van der Poel: 31-03-2010 Page 2 of 5 WARNING All samples and controls
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationAppendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A
Supplementary information Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their double drug resistant progeny (ABI 377). Primer set a,b Amplified cdna (base pairs) P1-hyg P2-neo All progeny
More informationElectronic Supplementary Information. Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA
Electronic Supplementary Information for Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA Shinsuke Sando,* Atsushi Narita, Masayoshi Hayami,
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More information