Bayesian Networks as framework for data integration

Size: px
Start display at page:

Download "Bayesian Networks as framework for data integration"

Transcription

1 Bayesian Networks as framework for data integration Jun Zhu, Ph. D. Department of Genomics and Genetic Sciences Icahn Institute of Genomics and Multiscale Biology Icahn Medical School at Mount Sinai New York,

2 Association vs Causality What are Bayesian networks? From Stephen Friend

3 A simple biological question: are there causal/reactive relationships?

4 A Bayesian network approach: Best model

5 A Bayesian network approach: Best models Markov Equivalent models A A A B C B C B C B A C

6 A Bayesian network a causal structure Markov Equivalent models A A B A C B C A B C B C

7 Bayesian network: how to break Markov equivalent? Animal model: mouse F2 intercrosses F0 F1 Diabetes resistant X Diabetes susceptible F2

8 General data flow genetic crosses White adipose Muscle Liver Brain Genotyping clinical traits Molecular profiling Constructing genetics map Scanning QTLs Network reconstruction

9 AACGGTT AACAGTT Causal inference: genetics Perturbations with a causal anchor --Natural variation in a segregating population provides the same type of causal anchor DNA Supporting Gene X Central Dogma of Biology Variation in DNA leads to variation in mrna High expression, alt splicing, codon change, etc. Low expression, no alt. splicing, no codon change, etc. Variation in mrna leads to variation in protein, which in turn can lead to disease Schadt et al. Nature Genetics (2005)

10 A Bayesian network approach: Best models Markov Equivalent models

11 Structure priors based on causality Estimate confidence of causality The pair is independent Bootstrap samples for 200 times Factions of causal, reactive, independent calls The pair is causa/reactive Zhu et al., PLoS CompBio, 2007

12 Bayesian network: integrating genetic data Give a sense of causality to Bayesian network how much improvement is achieved by integrating genetic data?

13 Bayesian Network: a simulation study Zhu et al., PLoS CompBio, 2007

14 Bayesian network: Genetics information is critical when sample size is small Largest improvement in recall occurs with smaller sample sizes Zhu et al., PLoS CompBio, 2007

15 Bayesian network: integrating genetic data Genetic loci L1 L2 Lj Ln-1 Ln Gene G1 G2 Gj Gn-1 Gn Cis-regulation trans-regulation Transcriptional regulation

16 precision 300 samples 900 samples 300 samples 900 samples Weak signals recall Strong signals

17 Bayesian network: why samples matter?

18 Bayesian network: integrating genetics Experimental Hsd11b1 signature : mice treated with Hsd1 inhibitor Prediction Hsd1 signatures based on BxD data Correlation to Hsd1 10% of predicted signature overlap with experimental one BN without genetics 20% of predicted signature overlap with experimental one BN with genetics 52% of predicted signature overlap with experimental one Zhu J et al, Cytogenet Genome Res. (2004)

19 A framework for data integration High throughput data knowledge Medline Biocarta/Biopathway Biologists Microarray data Proteomic data Metabolomic data probabilistic graphic models Database Genomics Genetics Hypothesis, test GUI

20 Bayesian network: PPI Zhu J et al, Nature Genetics, 2008

21 Bayesian network: PPI 4-clique 4-clique 3-clique 3-clique Clique community (partial clique) Zhu J et al, Nature Genetics, 2008

22 Bayesian network: PPI Zhu J et al, Nature Genetics, 2008

23 Bayesian network: Transcription Factors Is the TF is functional? Are genes B, C, D, and E are correlated? TF B C D E

24 Bayesian network: Transcription Factors Introducing scale-free priors for TF or protein complex p( T g) w( T) w( T) log( g i R r( T, g i ) r cutoff ) Zhu J et al, Nature Genetics, 2008

25 Yeast segregants Public databases Synthetic complete medium Logorithm growth Proteinprotein interations Gene expression genotypes Transcription factor binding sites Protein Metabolite interations Bayesian network Zhu J et al, Nature Genetics, 2008

26 Integration improves network qualities BN KO data GO terms TF data w/o any priors w/ genetics priors w/ genetics, TF and PPI priors Zhu J et al, Nature Genetics, 2008

27 Prospective validation is the gold standard ILV6 gives rise to large expression signature GCN4 ILV6 KO sig enriched (p~10e-52) GCN4 upregulated in ILV6 KO large signature ILV6 LEU2 KO gives rise to small expression signature LEU2 KO sig enriched (p~10e-18) GCN4 downregulated in LEU2 KO small signature GCN4 LEU2 Zhu J et al, Nature Genetics, 2008

28 How does LEU2 affect LEU3 activity? LEU3 binding sites mrna expression LEU2 LEU3 LEU2 Surrogate marker for Leu3p activity

29 A framework for building causal networks High throughput data knowledge Medline Biocarta/Biopathway Biologists Microarray data Proteomic data Metabolomic data probabilistic graphic models Database Genomics Genetics Hypothesis, test GUI

30 Yeast segregants Yeast segregants Public databases Synthetic complete medium Logorithm growth Proteinprotein interations Gene expression metabolites genotypes Transcription factor binding sites Protein Metabolite interations Bayesian network Zhu et al, PLoS Biology, 2012

31 Metabolite abundance is under genetic control Zhu et al, PLoS Biology, 2012

32 KEGG biochemical pathways d m, e p ( m e) e Zhu et al, PLoS Biology, 2012

33 LEU2 mrna is causal to 2-isopropylmalate KEGG pathway Zhu et al, PLoS Biology, 2012

34 LEU3 binding site LEU2 With metabolomic data

35 LEU3 regulation The activity of Leu3p is positively regulated by alphaisopropylmalate (IPM), the product of the first step in leucine biosynthesis Sze JY, et al. (1992) In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alphaisopropylmalate. Science 258(5085): The degree of activation by Leu3p is Leu3p concentration dependent, and it has been shown that LEU3 gene expression is regulated by general amino acid control, which is mediated by the GCN4 transcription factor Zhou K, et al. (1987) Structure of yeast regulatory gene LEU3 and evidence that LEU3 itself is under general amino acid control. Nucleic Acids Res 15(13):

36 2-isopropylmalate: mechanism of causal regulator LEU2 LEU2 genotype LEU2 activity 2-isopropylmalate Transcriptional response for genes with LEU3 binding sites LEU3 activity

37 Consistent with KEGG pathway Zhu et al, PLoS Biology, 2012

38 What else can you learn from integrating metabolomic data? Metabolite QTLs Causal candidates Metabolite Signature size KO Protein degradation

39 Zhu et al, PLoS Biology, 2012

40 Is the transcriptional effect real? Zhu et al, PLoS Biology, 2012

41 PHM7-ko affects many metabolites Zhu et al, PLoS Biology, 2012

42 Integration of CNV blocks into Bayesian networks Network-based model selection Random gene Tran et al. BMC Sys. Biol. 2011

43 Aknowledgements Sage Bionetworks Stephen Friend et al. Mount Sinai Eric Schadt Bin Zhang Zhidong Tu Decode Valur Emilsson UCLA Jake Lusis Xia Yang, et al U Washington Roger Baumgarner Berkerley Rachel Brem Princeton Lenoid Kruglyak Harvard Jun Liu U Wisconsin Alan Attie Mark Keller, et al Merck Qiuwei Xu Ethan Xu Theretha Zhang Fred Hutchingson Paddison lab MD Anderson Hanash lab Mount Sinai Powell lab Oh Lab Casaccia

44 Aknowledgements Icahn Institute of Genomics and Multiscale Biology, Icahn Medical School at Mount Sinai Canary Foundation Prostate Cancer Foundation NIH NCI

1. why study multiple traits together?

1. why study multiple traits together? Multiple Traits & Microarrays 1. why study multiple traits together? 2-10 diabetes case study 2. design issues 11-13 selective phenotyping 3. why are traits correlated? 14-17 close linkage or pleiotropy?

More information

Multiple Traits & Microarrays

Multiple Traits & Microarrays Multiple Traits & Microarrays 1. why study multiple traits together? 2-10 diabetes case study 2. design issues 11-13 selective phenotyping 3. why are traits correlated? 14-17 close linkage or pleiotropy?

More information

1 why study multiple traits together?

1 why study multiple traits together? Multiple Traits & Microarrays why map multiple traits together? central dogma via microarrays diabetes case study why are traits correlated? close linkage or pleiotropy? how to handle high throughput?

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Identification of Key Causal Regulators in Gene Networks

Identification of Key Causal Regulators in Gene Networks Lecture II Identification of Key Causal Regulators in Gene Networks Bin Zhang, PhD Jun Zhu, PhD Department of Genetics & Genomic Sciences Icahn Institute of Genomics and Multiscale Biology Icahn School

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Statistical Methods for Network Analysis of Biological Data

Statistical Methods for Network Analysis of Biological Data The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

Lecture: Genetic Basis of Complex Phenotypes Advanced Topics in Computa8onal Genomics

Lecture: Genetic Basis of Complex Phenotypes Advanced Topics in Computa8onal Genomics Lecture: Genetic Basis of Complex Phenotypes 02-715 Advanced Topics in Computa8onal Genomics Genome Polymorphisms A Human Genealogy TCGAGGTATTAAC The ancestral chromosome From SNPS TCGAGGTATTAAC TCTAGGTATTAAC

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls

Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls, Duke University Christopher D Brown, University of Pennsylvania November 9th,

More information

Computational Genomics. Reconstructing signaling and dynamic regulatory networks

Computational Genomics. Reconstructing signaling and dynamic regulatory networks 02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995

More information

Algorithms in Bioinformatics ONE Transcription Translation

Algorithms in Bioinformatics ONE Transcription Translation Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription

More information

Our website:

Our website: Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Bayesian Variable Selection and Data Integration for Biological Regulatory Networks

Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Shane T. Jensen Department of Statistics The Wharton School, University of Pennsylvania stjensen@wharton.upenn.edu Gary

More information

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs (3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

SGN-6106 Computational Systems Biology I

SGN-6106 Computational Systems Biology I SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th

More information

Metabolomics: Techniques and Applications ABRF

Metabolomics: Techniques and Applications ABRF Metabolomics: Techniques and Applications ABRF Sacramento, CA March 23, 2010 Overview Metabolomics Definitions Representative Project Sarcosine, a prostatic cancer biomarker Technical overview/ How we

More information

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA. Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal

More information

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010 Inferring Cellular Networks Using Probabilis6c Graphical Models Jianlin Cheng, PhD University of Missouri 2010 Bayesian Network So@ware hap://www.cs.ubc.ca/~murphyk/so@ware/ BNT/bnso@.html Demo References

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Random matrix analysis for gene co-expression experiments in cancer cells

Random matrix analysis for gene co-expression experiments in cancer cells Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k

More information

Illuminating Genetic Networks with Random Forest

Illuminating Genetic Networks with Random Forest ? Illuminating Genetic Networks with Random Forest ANDREAS BEYER University of Cologne Outline Random Forest Applications QTL mapping Epistasis (analyzing model structure) 2 Random Forest HOW DOES IT WORK?

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10

More information

The dissection of expression quantitative trait locus hotspots

The dissection of expression quantitative trait locus hotspots Genetics: Early Online, published on February 2, 216 as 1.1534/genetics.115.183624 The dissection of expression quantitative trait locus hotspots Jianan Tian, Mark P. Keller, Aimee Teo Broman, Christina

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

27041, Week 02. Review of Week 01

27041, Week 02. Review of Week 01 27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Saccharomyces cerevisiae

Saccharomyces cerevisiae Saccharomyces cerevisiae Acclimation to Cold Shock Revealed Change in Expression of Genes Involved With Ribosome Biogenesis, Mitosis, and Nitrogen Catabolism Acclimation of Saccharomyces cerevisiae to

More information

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common

More information

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1 Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation

More information

NGS Approaches to Epigenomics

NGS Approaches to Epigenomics I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic

More information

We have applied our network reconstruction algorithm to a yeast expression QTL data set in which microarray and marker data were collected from the

We have applied our network reconstruction algorithm to a yeast expression QTL data set in which microarray and marker data were collected from the ABSTRACT DUARTE, CHRISTINE W. A New Method for Genetic Network Reconstruction in Expression QTL Data Sets. (Under the direction of Professor Zhao-Bang Zeng). Expression QTL (or eqtl) studies involve the

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD Gene function prediction Computational analysis of biological networks. Olga Troyanskaya, PhD Available Data Coexpression - Microarrays Cells of Interest Known DNA sequences Isolate mrna Glass slide Resulting

More information

Ontologies - Useful tools in Life Sciences and Forensics

Ontologies - Useful tools in Life Sciences and Forensics Ontologies - Useful tools in Life Sciences and Forensics How today's Life Science Technologies can shape the Crime Sciences of tomorrow 04.07.2015 Dirk Labudde Mittweida Mittweida 2 Watson vs Watson Dr.

More information

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

ECS 234: Genomic Data Integration ECS 234

ECS 234: Genomic Data Integration ECS 234 : Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG

More information

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis The

More information

Functional profiling of metagenomic short reads: How complex are complex microbial communities?

Functional profiling of metagenomic short reads: How complex are complex microbial communities? Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,

More information

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Package trigger. R topics documented: August 16, Type Package

Package trigger. R topics documented: August 16, Type Package Type Package Package trigger August 16, 2018 Title Transcriptional Regulatory Inference from Genetics of Gene ExpRession Version 1.26.0 Author Lin S. Chen , Dipen P. Sangurdekar

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Learning a Prior on Regulatory Potential from eqtl Data

Learning a Prior on Regulatory Potential from eqtl Data Learning a Prior on Regulatory Potential from eqtl Data Su-In Lee 1, Aimée M. Dudley 2, David Drubin 3, Pamela A. Silver 3, Nevan J. Krogan 4, Dana Pe er 5, Daphne Koller 1 * 1 Computer Science Department,

More information

2. Materials and Methods

2. Materials and Methods Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all

More information

Gene expression connectivity mapping and its application to Cat-App

Gene expression connectivity mapping and its application to Cat-App Gene expression connectivity mapping and its application to Cat-App Shu-Dong Zhang Northern Ireland Centre for Stratified Medicine University of Ulster Outline TITLE OF THE PRESENTATION Gene expression

More information

HHS Public Access Author manuscript Nat Rev Genet. Author manuscript; available in PMC 2014 February 25.

HHS Public Access Author manuscript Nat Rev Genet. Author manuscript; available in PMC 2014 February 25. Systems genetics approaches to understand complex traits Mete Civelek 1,2,3 and Aldons J. Lusis 1,2,3 1 Department of Microbiology, Immunology, and Molecular Genetics, University of California, Los Angeles

More information

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes

More information

Systems genetics approaches to understand complex traits

Systems genetics approaches to understand complex traits Systems genetics approaches to understand complex traits Mete Civelek 1 3 and Aldons J. Lusis 1 3 Abstract Systems genetics is an approach to understand the flow of biological information that underlies

More information

Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources

Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources Jarek Meller, PhD BD2K-LINCS Data Coordination and Integration Center University of

More information

Network Analysis of Glycerol Kinase Deficient Mice Predicts Genes Essential for Survival: A Systems Biology Approach

Network Analysis of Glycerol Kinase Deficient Mice Predicts Genes Essential for Survival: A Systems Biology Approach Network Analysis of Glycerol Kinase Deficient Mice Predicts Genes Essential for Survival: A Systems Biology Approach NK MacLennan, J Dong, S Horvath, L Ornelas, L Rahib, K Dipple and ERB McCabe. UCLA,

More information

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Prostate Cancer Genetics: Today and tomorrow

Prostate Cancer Genetics: Today and tomorrow Prostate Cancer Genetics: Today and tomorrow Henrik Grönberg Professor Cancer Epidemiology, Deputy Chair Department of Medical Epidemiology and Biostatistics ( MEB) Karolinska Institutet, Stockholm IMPACT-Atanta

More information

Lecture 10. Ab initio gene finding

Lecture 10. Ab initio gene finding Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D. Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Identifying Signaling Pathways. BMI/CS 776 Spring 2016 Anthony Gitter

Identifying Signaling Pathways. BMI/CS 776  Spring 2016 Anthony Gitter Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Goals for lecture Challenges of integrating high-throughput assays Connecting relevant

More information

Every object that biology studies is a system of systems (1974) Francois Jacob (1965 Nobel Prize in Medicine)

Every object that biology studies is a system of systems (1974) Francois Jacob (1965 Nobel Prize in Medicine) Every object that biology studies is a system of systems (1974) Francois Jacob (1965 Nobel Prize in Medicine) 2 Reductionism vs Holism (Aristotle, 1946) The whole is something over and above its parts

More information

From genome-wide association studies to disease relationships. Liqing Zhang Department of Computer Science Virginia Tech

From genome-wide association studies to disease relationships. Liqing Zhang Department of Computer Science Virginia Tech From genome-wide association studies to disease relationships Liqing Zhang Department of Computer Science Virginia Tech Types of variation in the human genome ( polymorphisms SNPs (single nucleotide Insertions

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Learning Methods for DNA Binding in Computational Biology

Learning Methods for DNA Binding in Computational Biology Learning Methods for DNA Binding in Computational Biology Mark Kon Dustin Holloway Yue Fan Chaitanya Sai Charles DeLisi Boston University IJCNN Orlando August 16, 2007 Outline Background on Transcription

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Genomics and Proteomics *

Genomics and Proteomics * OpenStax-CNX module: m44558 1 Genomics and Proteomics * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

ECS 234: Introduction to Computational Functional Genomics ECS 234

ECS 234: Introduction to Computational Functional Genomics ECS 234 : Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: Wednesday, 1:30-3p Ask me or email me any time for appt

More information

Advanced Algorithms and Models for Computational Biology

Advanced Algorithms and Models for Computational Biology 10-810 Advanced Algorithms and Models for Computational Biology Ziv Bar-Joseph zivbj@cs.cmu.edu WeH 4107 Eric Xing epxing@cs.cmu.edu WeH 4127 http://www.cs.cmu.edu/~epxing/class/10810-06/ Topics Introduction

More information

Uncovering differentially expressed pathways with protein interaction and gene expression data

Uncovering differentially expressed pathways with protein interaction and gene expression data The Second International Symposium on Optimization and Systems Biology (OSB 08) Lijiang, China, October 31 November 3, 2008 Copyright 2008 ORSC & APORC, pp. 74 82 Uncovering differentially expressed pathways

More information

THERE is a long history of efforts to map the genetic loci. The Dissection of Expression Quantitative Trait Locus Hotspots INVESTIGATION

THERE is a long history of efforts to map the genetic loci. The Dissection of Expression Quantitative Trait Locus Hotspots INVESTIGATION INVESTIGATION The Dissection of Expression Quantitative Trait Locus Hotspots Jianan Tian,* Mark P. Keller, Aimee Teo Broman, Christina Kendziorski, Brian S. Yandell,*, Alan D. Attie, and Karl W. Broman,1

More information

MANIFESTO OF STUDIES 2012

MANIFESTO OF STUDIES 2012 MANIFESTO OF STUDIES 2012 1st YEAR Course Teacher Hours Synopsis Evaluation procedure Laboratory Safety Course (Mandatory) Prof. Mancini I. Dr. Provenzani A. 12 General Laboratory Procedures, Equipment

More information

The genetic code of gene regulatory elements

The genetic code of gene regulatory elements The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts

More information

Stefano Monti. Workshop Format

Stefano Monti. Workshop Format Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

How to deal with the microarray results.

How to deal with the microarray results. How to deal with the microarray results. Britt Gabrielsson PhD RCEM, Div of metabolism and cardiovascular research Department of Medicine The Sahlgrenska Academy at Göteborg University and then we will

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Alexander Statnikov, Ph.D.

Alexander Statnikov, Ph.D. Alexander Statnikov, Ph.D. Director, Computational Causal Discovery Laboratory Benchmarking Director, Best Practices Integrative Informatics Consultation Service Assistant Professor, Department of Medicine,

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology Natural Resources Institute Finland (Luke) Environment nutrition dieseases stress Rumen microbiome composition (taxa; genes) function (metatranscriptome,

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Thyroid hormone transcriptome and cerebellum development.

Thyroid hormone transcriptome and cerebellum development. Thyroid hormone transcriptome and cerebellum development. 1) Developmental biology: General concepts 2) Genomic data: mouse and human genomes global view 3) A biological problem: mouse cerebellum and thyroid

More information