CHAPTER 21 LECTURE SLIDES

Size: px
Start display at page:

Download "CHAPTER 21 LECTURE SLIDES"

Transcription

1 CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please note: once you have used any of the animation functions (such as Play or Pause), you must first click in the white background before you advance the next slide. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

2 The unifying theme of biology is evolution The genome of every living species is the product of over 3.5 billion years of evolution All species evolved from an interrelated group of ancestors 2

3 Prokaryotic genomes Of interest because Bacteria cause diseases Can apply knowledge to more complex organisms Origin of first eukaryotic cell probably involved the union between an archaeal and bacterial cell 3

4 Venter, Smith, and Colleagues Sequenced the First Complete Genome in 1995 Haemophilus influenzae causes a variety of human diseases Relatively small genome 1.8 Mb One strategy for mapping large genomes is extensive mapping Alternative is shotgun DNA sequencing Randomly sequence fragments Does not require extensive mapping but you may waste time sequencing the same DNA region

5

6 Eukaryotic genomes Nuclear genome usually found in sets of linear chromosome Extranuclear DNA found in mitochondria and chloroplasts Entire nuclear genome sequenced for several species 6

7 4 motivators to sequence genome 1. Great benefit from identifying and characterizing genes in model organisms 2. More information to identify and treat human diseases 3. Improved strains of agricultural species 4. Way to establish evolutionary relationships 7

8 Genome size is not the same as the number of genes In general, increases in the amount of DNA are correlated with increasing cell size, cell complexity and body complexity However, major variations are observed between organisms with similar form and function 8

9 Eukaryotic genomes have repetitive sequences Many copies of short DNA sequences Moderately repetitive sequences Few hundred to several thousand times rrna genes, multiple origins of replication, or role in gene transcription and translation Highly repetitive sequences Tens of thousands or millions of times Most have no known function Coding regions are only 2% of our genome 9

10 Percentage in the human genome Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display % % 15% 0 2% Regions of Introns and Unique genes that other parts noncoding encode of genes DNA proteins such as (exons) or enhancers give rise to rrna or trna Classes of DNA sequences Repetitive DNA 10

11 Repetitive Sequences Within a species, sequences of repeat units are conserved. However, the number of repeat units is variable among individuals DNA fingerpriniting exploits differences in DNA polymorphisms 11

12 12

13 Transposable elements Transposition short segment of DNA moves from original site to a new site Transposable elements (TEs) DNA segments that move Jumping genes Found in all species examined First discovered by Barbara McClintock 1983, awarded Nobel Prize 13

14 DNA transposons Both ends have inverted repeats (IRs), DNA sequences that are identical (or very similar) but run in opposite directions TEs may contain a central region that encodes transposase, an enzyme that facilitates transposition 14

15 Cut-and-paste mechanism Transposase recognizes IR and then removes sequence from original site Complex moves to new location where transposase inserts it into the chromosome 15

16 RNA intermediates Common only in eukaryotes Retroelement contains reverse transcriptase and transposase Reverse transcriptase uses RNA as a template to make a complementary copy of DNA Retroelements may accumulate rapidly in a genome Alu elements are 10% of human genome 16

17 Role of transposable elements Selfish DNA hypothesis TEs exist solely because they have characteristics that allow them to insert themselves into the host cell DNA Resemble parasites, can do harm Others argue TEs may benefit a species Promote genetic variation 17

18 Gene duplication Provide raw material for the addition of more genes into a species genome Create homologous genes Two or more genes that are derived from the same ancestral gene Over the course of many generations, each version of the gene accumulates different mutations Genes with similar but not identical DNA sequences 18

19

20 Mechanism Gene duplication caused by misaligned crossovers 2 homologous chromosomes have paired during meiosis but the homologs are misaligned If a crossover occurs, one chromosome gets a gene duplication, one a gene deletion and 2 are normal 20

21 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. A B C D A A B C B C D D A B C D Following meiosis 21

22 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. A B C D A A B C B C D D Misaligned crossover between homologous chromosomes A B C D Following meiosis A B C D A B C C D A B D Gene duplication A B C D Deletion (b) Mechanism of gene duplication 22

23 Paralogs Two or more homologous genes within a single species Gene family Two or more paralogous genes that carry out related functions 23

24 Globin genes Encode polypeptides that are subunits of proteins that function in oxygen binding 14 paralogs derived from a single ancestral globin gene Duplications and rearrangements occurred Mutations have created specialized globins Hemoglobin, myoglobin, embryonic and fetal forms Based on differences in oxygen transport needs 24

25 Millions of years ago (mya) Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chromosome 22 Mb Chromosome 16 Chromosome 11 α2 α1 α 2 α 1 e g G g A C β β α-globins β-globins 400 Myoglobin Hemoglobins ,000 Pseudogenes Ancestral globin Genes that have been produced by gene duplication but have accumulated mutations that make them nonfunctional Not transcribed into RNA Nonfunctional pseudogenes 25

26 Human Genome Project Officially began October 1, 1990 Largely finished by end of 2003 Goals Identify all human genes Sequence entire human genome Develop technology Analyze genomes of model organisms Develop legal, ethical and social programs addressing the results 26

27 Proteomes Relative abundance of proteins Abundance in genome Number of genes that encode a particular type of category of protein Abundance in cell Amount of a given protein or protein category actually made by a living cell Liver/muscle cell example Same genes so % in genome identical Cellular abundance very different 27

28 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Liver cell Skeletal muscle cell Abundance in genome Abundance in genome Genes for metabolic 25% enzymes Genes for structural 5% proteins Genes for motor < 2% proteins Abundance in cell Genes for metabolic 25% enzymes Genes for structural 5% proteins Genes for motor < 2% proteins Abundance in cell Metabolic enzymes > 50% Structural proteins < 10% Motor proteins < 5% Metabolic enzymes < 10% Structural proteins 20 30% Motor proteins 25 40% 28

29 Proteomes are larger than genomes Due to Alternative splicing A single pre-mrna can be spliced into more than one version Often cell specific or related to environmental conditions Post-translational covalent modification Permanent or reversible Involved in assembly and construction of protein Phosphorylation, methylation, acetylation 29

30 pre-mrna Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Alternative splicing Translation Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Permanent modifications Proteolytic processing Exon 1 Exon 4 Exon 6 Exon 2 Exon 5 or SH SH Disulfide bond formation S S Exon 1 Exon 4 Exon 6 Exon 3 Exon 5 or Exon 1 Exon 4 Exon 2 Exon 6 Attachment of prosthetic groups, sugars, or lipids Sugar Heme group (a) Alternative splicing Phospholipid Reversible modifications Phosphorylation Acetylation PO 4 2 O C CH 3 Phosphate group Acetyl group Methylation CH 3 Methyl group (b) Post-translational covalent modification 30

31 Bioinformatics Use of computers, mathematical tools, and statistical techniques to record, store, and analyze biological information More than just DNA sequences Highly interdisciplinary, incorporating principles from mathematics, statistics, information science, chemistry, and physics 31

32 Issues of size and speed in analyzing huge volumes of data Computational molecular biology Uses computers to characterize the molecular components of living things 32

33 First step is to collect and store data Then write programs to analyze sequences in particular ways Translate DNA sequence into amino acid sequence results for all 3 reading frames May also not know which strand is coding strand so results for both strands 33

34 34

35 Databases Collect large numbers of files and store them in one place for rapid search and retrieval Additional descriptive information included Research community has collected genetic information from thousands of research labs and created several large databases 35

36 Identify homologous sequences Can use computer to identify genes that are evolutionarily related Closely related organisms tend to have genes with similar DNA sequences Ortholog homologous genes in different species Helps us understand evolutionary relationships 36

37 Time Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Mouse GGGCAGGTTGGTATCCAGGTTACAAGG C AGCTC AC AAGTAGAAG C T G GGTGCTTGGAGAC GGGCAGGTTGGTATCCAGGTTACAAGG T AGCTC CT AAGTAGAAG T T T GGTGCTTGGAGAC Rat (a) A comparison of one DNA strand of the mouse and rat -globin genes X X X X X Mus musculus Random mutations Rattus norvegicus -globin gene in common ancestor to mice and rats (b) The formation of homologous -globin genes during evolution of mice and rats 37

38 A matrix can be used to compare 2 sequences DNA sequences are long so use more complex dynamic programming methods 38

39 BLAST Homologous genes usually carry out similar or identical functions First indication of function for a new sequence is through homology to known sequences Basic Local Alignment Search Tool (BLAST) Uses particular genetic sequence to find homologous sequences in a large database 39

40 Sample BLAST Order follows evolutionary relatedness of various species to humans Main power of the BLAST program is its use with newly identified sequences, in which a researcher does not know the function of a gene or an encoded protein 40

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger.

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger. How does the human genome stack up? Organism Human (Homo sapiens) Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster) Yeast (S. cerevisiae) Bacterium

More information

CHAPTER 21 GENOMES AND THEIR EVOLUTION

CHAPTER 21 GENOMES AND THEIR EVOLUTION GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of

More information

How to Use This Presentation

How to Use This Presentation How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Chapter 19. Control of Eukaryotic Genome. AP Biology

Chapter 19. Control of Eukaryotic Genome. AP Biology Chapter 19. Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

A primer on the structure and function of genes

A primer on the structure and function of genes A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences

More information

Genomes and Their Evolution

Genomes and Their Evolution 18 CAMPBELL BIOLOGY IN FOCUS Genomes and Their Evolution URRY CAIN WASSERMAN MINORSKY REECE Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION Overview:

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Unit 1 Human cells. 1. Division and differentiation in human cells

Unit 1 Human cells. 1. Division and differentiation in human cells Unit 1 Human cells 1. Division and differentiation in human cells Stem cells Describe the process of differentiation. Explain how differentiation is brought about with reference to genes. Name the two

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

GENES AND CHROMOSOMES II

GENES AND CHROMOSOMES II 1 GENES AND CHROMOSOMES II Lecture 4 BIOL 266/2 2014-15 Dr. S. Azam Biology Department Concordia University 2 GENE AND THE GENOME The Structure of the Genome DNA fingerprinting 3 DNA fingerprinting: DNA-based

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Differences between prokaryotes & eukaryotes. Gene function

Differences between prokaryotes & eukaryotes. Gene function GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences

More information

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule; Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT? BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles

More information

CS313 Exercise 1 Cover Page Fall 2017

CS313 Exercise 1 Cover Page Fall 2017 CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information? DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

GENE REGULATION IN PROKARYOTES

GENE REGULATION IN PROKARYOTES GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to

More information

2012 GENERAL [5 points]

2012 GENERAL [5 points] GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I 7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next

More information

Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms,

Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms, Gene Structure-Introns, Exons and Pseudogenes... What is a gene? Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms, is a nucleotide sequence necessary for the synthesis

More information

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:

BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson: BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

Chapter 20. Gene creatures, partii: jumping genes and junk DNA. Prepared by Woojoo Choi

Chapter 20. Gene creatures, partii: jumping genes and junk DNA. Prepared by Woojoo Choi Chapter 20. Gene creatures, partii: jumping genes and junk DNA Prepared by Woojoo Choi 1) Transposable elements (transposons): segment of DNA that can move as a unit from one location to another, but which

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 16 The Molecular Basis of Inheritance Concept 16.1 DNA is the

More information

"PhD Course Fall 2017"

PhD Course Fall 2017 Prof. Fahd M. Nasr Faculty of Sciences Lebanese University Beirut, Lebanon Winding your way through the genome, transcriptome, proteome to human diseases "PhD Course Fall 2017" Lecture 3 1 Genome structure,

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Study Guide A. Answer Key

Study Guide A. Answer Key From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.

More information

Assembling Protein Molecules

Assembling Protein Molecules How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Section 3: DNA Replication

Section 3: DNA Replication Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also

More information

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA 4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation

More information