Supplementary Figure. S1

Size: px
Start display at page:

Download "Supplementary Figure. S1"

Transcription

1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes ( /ml) were labelled with APC conjugated anti CD14 mab alone (for YG beads uptake) or in combination with FITC conjugated anti CD16 mab (for YO beads uptake). Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of fluorescent beads in gated monocyte as indicated (n = 29). Linear regression was used to compare YG and YO beads uptake.

2 Supplementary Figure. S2 Supplementary Figure S2. Correlation between the basal phagocytic ability of monocyte subsets and the Aβ amyloid burden. Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of fluorescent beads in gated monocyte as indicated (n = 87). Linear regression between the basal phagocytic ability and PET Aβ score is shown for intermediate(top) and classic monocytes (bottom). There was no correlation between Aβ amyloid burden and basal phagocytic ability of non classical monocytes (data not shown).

3 Supplementary Figure. S3 Supplementary Figure S3. Aβ peptides promote phagocytosis of YG beads by human monocytes. Fresh human monocytes ( /ml) were labelled with APC conjugated CD14 and the fluorescence intensity of CD14 + monocytes was analysed by real time flow cytometry. Monocytes were incubated with freshly prepared Aβ 40 or Aβ 42 (50 µg/ml in DMSO) for 15 minutes before the addition of beads. (a) A typical YG beads uptake curve shows the promoting effect of Aβ 40 and Aβ 42 on phagocytosis of beads. (b) Quantitative analysis of the promoting effect of Aβ 40 and Aβ 42 on phagocytosis of YG beads by monocytes as compared with untreated cells (n = 4).

4 Supplementary Figure. S4 Supplementary Figure S4. CPX promotes phagocytosis of YO beads by monocytes. (a) Fresh human monocytes ( /ml) were labelled with APC conjugated anti CD14 and FITCconjugated anti CD16 antibodies and the fluorescence intensity of CD14 + CD16 monocytes was analysed by real time flow cytometry. Cells were pretreated with or without 100 µg/ml CPX for 10 min at 37 o C and left on ice or kept at 37 o C for another 5 min. The 6 min YO bead uptake was performed either at 37 o C or 5 o C as indicated. Results are representative data from three individuals. (b) Concentration dependent promoting effect of CPX on phagocytosis of YG beads. Human monocytes were pre treated with different concentrations of CPX for 10 min at 37 o C. The increment of phagocytosis stimulated by CPX is normalized as % of basal phagocytosis level (n = 3).

5 Supplementary Figure. S5 Phagocytosis ability (area under curve for YO beads uptake in the first 6 min) Supplementary Figure S5. The effect of Copaxone on phagocytosis of YO beads by human monocytes from HC, MCI and AD patitipants. Fresh human PBMCs were collected from participants with MCI or AD, as well as age and ethnicity matched healthy controls. Cells were labelled with APC conjugated CD14 mab and FITCconjugated CD16 mab and incubated with or without Copaxone 100 µg/ml for 10 minute prior to the addition of 1 µm YO beads. Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of YO beads. Monocyte subsets are gated as indicated.

6 Supplementary Figure. S6 Phagocytosis ability (area under curve for YO beads uptake in the first 6 min) Supplementary Figure S6. The effect of Copaxone on phagocytosis of YO beads by human monocytes from Aβ, Aβ + and Aβ ++ participants. Fresh human PBMCs were collected from participants who had PET Aβ imaging results. Cells were labelled with APC conjugated CD14 mab and FITC conjugated CD16 mab and incubated with or without Copaxone 100 µg/ml for 10 minute prior to the addition of 1.0 µm YO beads. Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of YO beads. Monocyte subsets are gated as indicated.

7 Supplementary Figure. S7 Phagocytosis ability (area under curve for YO beads uptake in the first 6 min) Supplementary Figure S7. The effect of ATP on phagocytosis of YO beads by human monocytes from HC, MCI and AD participants. Fresh human PBMCs were collected from participants with MCI or AD, as well as age and ethnicity matched healthy controls. Cells were labelled with APC conjugated CD14 mab and FITC conjugated CD16 mab and incubated with or without 1 mm ATP for minute prior to the addition of 1.0 µm YO beads. Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of YO beads. Monocyte subsets are gated as indicated.

8 Supplementary Figure. S8 Phagocytosis ability (area under curve for YO beads uptake in the first 6 min) Supplementary Figure S8. The effect of ATP on phagocytosis of YO beads by human monocytes from Aβ, Aβ + and Aβ ++ participants. Fresh human PBMCs were collected from participants who have had PET Aβ imaging results. Cells were labelled with APC conjugated CD14 mab and FITC conjugated CD16 mab and incubated with or without 1 mm ATP for min prior to the addition of 1 µm YO beads. Phagocytosis ability was quantitated as arbitrary units of area under bead uptake curve in the first 6 min after the addition of YO beads. Monocyte subsets are gated as indicated.

9 Supplementary Figure. S9 Supplementary Figure S9. P2X7 surface expression on monocyte subsets. Whole peripheral blood (100 µl) was incubated with FITC conjugated mouse anti CD16 mab, PE conjugated mouse anti human CD14 mab and Alexa647 conjugated mouse anti human P2X7 mab (clone L4) for 20 min at 4 o C in dark, followed by addition of 2 ml 1 FACS lysing buffer (BD Bioscience). After 10 min, equal volume of PBS was added and leukocytes were centrifuged at 1400rpm for 4 min. Cells were analysed by flow cytometry on gated subsets of monocytes according to surface CD14 and CD16 expression.

10 Supplementary Figure. S10 a. b. Ethidium uptake c. Supplementary Figure S10. The effect of CPX is independent of the P2X7 receptor. (a) ATP induced ethidium uptake measured by real time flow cytometry. Human PBMCs were pre treated with or without 20 or 100 µg/ml CPX for 10 min prior to the addition of ethidium and ATP. CD14 + monocytes were gated for analysis. (b) Human PBMCs were pre treated with 1.0 mm ATP for 15 min and/or 100 µg/ml CPX for 10 min prior to the addition of YG beads. CD14 + monocytes were gated for analysis. (c) PBMCs from P2X7 knockout mice were pretreated with or without 100 µg/ml CPX for 10 min prior to the addition of YG beads. CD11b + monocytes were gated for analysis.

11 Supplementary Figure. S11 a. % of Max Autofluorescence Isotype control with secondary Ab W0 2 staining (untreated) W0 2 staining (fresh Aβ 1 42 treated) W0 2 staining (old Aβ 1 42 treated) b. W0 2 binding on monocyte surface Supplementary Figure S11: (a). Aβ 1 42 binds to monocyte surface. Heparin anti coagulated human blood was incubated with 50 μg/ml of Aβ 1 42 for 5 min prior to washing and the addition of anti Aβ mab (clone W0 2, Ida et al, J. Biol. Chem. 271:22908, 1996) for 20 min at 4 o C. After two washes, cells were stained with FITC anti mouse Ig Ab. (b). Carboxylated YO beads were covalently coupled with fresh prepared Aβ 1 42 peptides by the Carbodiimide method according to the manufacturer s instruction, and resuspended to the same density as unopsonized beads. CD14 and CD16 labeled PBMCs were incubated with or without 100 μg/ml CPX for 10 min at 37 o C then cooled down in ice for another 10 min. The uptake assay was performed at either 4 o C or 37 o C with time zero module.

12 Supplementary Figure. S12 Supplementary Figure S12: Comparison of YO beads uptake and Aβ YO beads uptake by monocyte subset from the same individual. PBMCs were prelabeled with FITC CD16 and APC CD14 mab and incubated with or without 100 μg/ml CPX or 1 mm ATP for min, followed by the addition of 5 µl 1 µm carboxylated YO beads or Aβ 1 42 opsonized YO beads. Typical uptake curves by one each of Aβ, Aβ + and Aβ ++ subjects are shown.

13 Supplementary Figure. S13 Supplementary Figure S11. Copaxone and ATP indices are independent of ApoE isoforms. Participants are grouped according to their ApoE ε4 allele status (ε4 : ε2 or ε3 carriers; ε4 + : ε4 heterozygotes or homocygotes). Basal phagocytic ability as well as the CPX stimulated phagocytosis index (CPX index) and ATP inhibited phagocytosis index (ATP index) are shown in different monocyte subsets.

Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay

Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay Supplementary Methods Antibodies for flow cytometry HLA-Cw3 and CD2 expression: LCL 72.22 cell lines were stained with anti-hla-abc-apc (clone G46-2.6, BD) or migg-apc (clone MOPC-2, BD) antibody, or with

More information

E. coli Phagocytosis Assay Kit

E. coli Phagocytosis Assay Kit E. coli Phagocytosis Assay Kit Item No. 601370 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Phagocytosis Assay Kit (IgG PE)

Phagocytosis Assay Kit (IgG PE) Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

ab pdc Subset Phenotyping Kit

ab pdc Subset Phenotyping Kit ab177772 pdc Subset Phenotyping Kit Instructions for Use A set of antibodies designed to identify pdcs and subsets of pdcs by multi-color flow cytometry. This product is for research use only and is not

More information

CFSE Cell Division Assay Kit

CFSE Cell Division Assay Kit CFSE Cell Division Assay Kit Item No. 10009853 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description

More information

PITT ISL METHODS 1) Flow-based CTL assay 2) Gut Mucosal Processing

PITT ISL METHODS 1) Flow-based CTL assay 2) Gut Mucosal Processing PITT ISL METHODS 1) Flow-based CTL assay a. Purified CD8 + T cells are co-cultured with fresh, autologous, infected CD4 + T cells at various effector/target ratios for 18 hours at 37 o C. b. Baseline percentage

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.

Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque

More information

CFSE Cell Division Assay Kit

CFSE Cell Division Assay Kit CFSE Cell Division Assay Kit Catalog Number KA1302 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Flow Cytometry Immune Activation SOP

Flow Cytometry Immune Activation SOP Flow Cytometry Immune Activation SOP Purpose This SOP standardizes the procedure for measuring immune activation of T cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow

More information

Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer

Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer APPLICATION NOTE Attune Acoustic Focusing Cytometer Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer Circulating endothelial cells (CECs) are mature cells shed

More information

7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.

7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells. Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,

More information

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,

More information

Flow Cytometry SOP: Monocytes from Frozen Cells

Flow Cytometry SOP: Monocytes from Frozen Cells Flow Cytometry SOP: Monocytes from Frozen Cells Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow tubes

More information

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes

More information

InhibiScreen Kinase Inhibitor Assay

InhibiScreen Kinase Inhibitor Assay InhibiScreen Kinase Inhibitor Assay Flow Cytometric assessment of efficacy of PI3Kγ, PI3Kδ, BTK and SYK pathway inhibitors using the measurement of basophil activation in human EDTA and Heparin Whole Blood.

More information

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions

More information

Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application

Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer Application Gerd Luedke and Tobias Preckel Abstract This Application Note describes how the

More information

SOPVII-7. Panel X: NK-characterization

SOPVII-7. Panel X: NK-characterization Created by judith.eckl Page 1 of 8 09/06/2011 SOPVII-7 Panel X: NK-characterization Date: Author: Petra Prinz, Judith Eckl Experimenter: Date: 08/06/2011 Experiment description: Version: 1.0 Start: End:

More information

IncuCyte Live-Cell Immunocytochemistry Assay

IncuCyte Live-Cell Immunocytochemistry Assay IncuCyte Live-Cell Immunocytochemistry Assay For cell surface marker analysis This protocol describes a solution for measuring immunocytochemistry in live-cells expressing a surface antigen of interest.

More information

Supporting information. Supplementary figures.

Supporting information. Supplementary figures. Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number

More information

BD Multicolor CompBeads

BD Multicolor CompBeads 4/2015 23-9955-01 IVD BD Multicolor CompBeads 100 compensation setups Catalog No. 644204 BD, BD Logo and all other trademarks are property of Becton, Dickinson and Company. 2015 BD Becton, Dickinson and

More information

Supporting Information

Supporting Information Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the

More information

High-throughput automation with the Attune NxT Autosampler: consistent results across all wells and across plates

High-throughput automation with the Attune NxT Autosampler: consistent results across all wells and across plates APPLICATION NOTE Attune NxT Flow Cytometer with Autosampler High-throughput automation with the Attune NxT Autosampler: consistent results across all wells and across plates Introduction The emerging field

More information

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining The capability of cells, either PBMC or purified T- cell lines, to inhibit parasite growth or merozoite

More information

Isolation of mouse monocytes: Mouse monocytes were isolated using a modified

Isolation of mouse monocytes: Mouse monocytes were isolated using a modified Supplemental Material Extended Methods Isolation of mouse monocytes: Mouse monocytes were isolated using a modified method described (1). Citrated mouse whole blood was mixed with equal volume of PBS,

More information

Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads

Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads S S Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads (Miltenyi Biotech) and T cells were positively selected by magnetically activated cell sorting (MACS). 50x10 6 or greater

More information

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases

More information

Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion

Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories.

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein

More information

Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note

Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer Application Note Sylvie Veriac Valérie Perrone Madeleine Avon Abstract Agilent Equipment: 2100 bioanalyzer

More information

TECHNICAL BULLETIN. QUANTUM SIMPLY CELLULAR KIT Product Numbers QSC-20 AND QSC-100 Storage Temperature 2-8 C. Do Not Freeze

TECHNICAL BULLETIN. QUANTUM SIMPLY CELLULAR KIT Product Numbers QSC-20 AND QSC-100 Storage Temperature 2-8 C. Do Not Freeze QUANTUM SIMPLY CELLULAR KIT Product Numbers QSC-20 AND QSC-100 Storage Temperature 2-8 C. Do Not Freeze TECHNICAL BULLETIN Product Description The Quantum Simply Cellular Kit provides a convenient method

More information

Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide

Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.

More information

Assay Name: Antibody-Dependent Drug Uptake Assay

Assay Name: Antibody-Dependent Drug Uptake Assay Assay Name: Antibody-Dependent Drug Uptake Assay Assay ID: Celigo_02_0019 Table of Contents Experiment: Antibody-Dependent Drug Uptake Assay... 2 Celigo Setup...2 Assay Protocol and Plate Setup...3 Results...5

More information

No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)

No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%) Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human

More information

Immunofluorescent staining and flow cytometric analysis of cells

Immunofluorescent staining and flow cytometric analysis of cells UCAN-U 0003 Version 1 November 2010 Page 1 of 7 CMCI (Center for molecular and Cellular Intervention) University Medical Center Utrecht Written By Name Function Date Signature Mark Klein Lab manager Conformation

More information

Ruud Hulspas, Mike Keeney, Ben Hedley and Andrea Illingworth

Ruud Hulspas, Mike Keeney, Ben Hedley and Andrea Illingworth Sponsored and reviewed by ICCS Quality and Standards Committee Title: Quality of Reagents Monoclonal Antibodies Written by: Date: March 6, 2018 Ruud Hulspas, Mike Keeney, Ben Hedley and Andrea Illingworth

More information

Reagent Titration for the ICS Assay

Reagent Titration for the ICS Assay Purpose This standard operating procedure (SOP) describes how to titrate new lots of fluorochromeconjugated antibody reagents and the cell viability marker for use in the intracellular cytokine staining

More information

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar *

Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar * Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar * Department of Comparative Medicine, University of Washington, Seattle, USA *For correspondence: csyam@u.washington.edu; hajjar@uw.edu

More information

Multicolor flow cytometry analysis of human pluripotent stem cell cultures

Multicolor flow cytometry analysis of human pluripotent stem cell cultures Multicolor flow cytometry analysis of human pluripotent stem cell cultures ackground Thorough characterization of pluripotency is mandatory during the establishment of newly derived human embryonic or

More information

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior

More information

Flow Cytometry Support Reagents

Flow Cytometry Support Reagents Excite and inspire Flow Cytometry Support Reagents Introduction Miltenyi Biotec is a leading supplier of flow cytometry products, offering one of the broadest ranges of antibodies, kits, assays, and support

More information

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer Wenli Yang 1, Jason A. Mills 2, Spencer Sullivan 3, Ying Liu 1, Deborah L. French 2 and Paul Gadue 2, 1 Institute

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Siglec-7 Engagement by GBS -protein Suppresses Pyroptotic Cell Death of Natural Killer Cells Jerry J. Fong a,b, Chih-Ming Tsai a,b, Sudeshna Saha a,b, Victor Nizet a,c,d Ajit

More information

SOPVII-7. Panel VII: Treg-FACS-staining

SOPVII-7. Panel VII: Treg-FACS-staining Created by judith.eckl Page 1 of 6 09/06/2011 SOPVII-7 Panel VII: Treg-FCS-staining Date: uthor: Judith Eckl Experimenter: Date: 08/05/2011 Experiment description: Version: 1.0 Start: End: ackground information:

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Nature Biotechnology: doi: /nbt.4086

Nature Biotechnology: doi: /nbt.4086 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3

More information

TECHNICAL REPORT. Experimental Campaign on the in-vitro platelet-endothelial cells interactions

TECHNICAL REPORT. Experimental Campaign on the in-vitro platelet-endothelial cells interactions TECHNICAL REPORT Experimental Campaign on the in-vitro platelet-endothelial cells interactions Marco Malvestiti, Paolo Gresele Department of Internal Medicine, University of Perugia, Perugia, Italy marco.malvestiti@gmail.com,

More information

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis LABORATORY PROCEDURE: IMMUNOPHENOTYPING: Lymphocyte Staining for FACS Analysis Date: April 29 2014 Authors: Jennifer Hossler PURPOSE: To delineate the subsets of human lymphocytes based on the expression

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

Supporting Information

Supporting Information Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A THP-1 cells B THP-1 cells LPS + LPS + + EDTA C human monocytes D + EDTA LPS + LPS + +EDTA E control IgG 5 µg/ml IgG 50 µg/ml! F G Supplementary Figure 1: Binding of to THP-1 cells

More information

Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect

Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Canine Amyloid-Beta A ELISA Protocol FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. cab1-40elisa FIVEphoton Biochemicals 4907 Morena Blvd, Ste 1403 San Diego, CA 92117 Tel:

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated

A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated cancer therapeutic antibodies Supplemental Data File in this Data Supplement: Supplementary Figure 1-4

More information

Understanding Flow Cytometry

Understanding Flow Cytometry Understanding Flow Cytometry The Basic Concepts Maree Bagnara Products Sales Specialist/Account Manager Flow Cytometry PN775136 1 Successful Flow Cytometry data is driven by.. Understanding the Biology

More information

ATPlite Assay Performance in Human Primary Cells

ATPlite Assay Performance in Human Primary Cells A P P L I C AT I O N N O T E Cell Viability Assays Author: Verena Brucklacher-Waldert Crescendo Biologics Cambridge, UK Assay Performance in Human Primary Cells Introduction In vitro assays using primary

More information

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti

More information

Neutrophil/Monocyte Respiratory Burst Assay Kit

Neutrophil/Monocyte Respiratory Burst Assay Kit Neutrophil/Monocyte Respiratory Burst Assay Kit Item No. 601130 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS

More information

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort

More information

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Supplemental Table 1 Primers used in study. Human. Mouse

Supplemental Table 1 Primers used in study. Human. Mouse Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc

More information

Supplementary Materials and Methods:

Supplementary Materials and Methods: Supplementary Materials and Methods: Reagents Immune complexes (ICs) were prepared as described previously (31). In short, FITC-labeled human serum albumin (HSA, 1 mg/ml) (Abcam) was incubated with polyclonal

More information

QS S Assist STK_FP Kit

QS S Assist STK_FP Kit QS S Assist STK_FP Kit Description STK FP kit is designed for use in pharmacological assays for STK based on fluorescence polarization. The kit includes assay buffer, human protein kinase, ATP/fluorescence-

More information

15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%

15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53% a None Apoptotic cells Apoptotic LPS blasts 30% 32% 32% Apoptotic cells + Exogenous LPS 6h 0.1% 31% 21% 20% 48% 60% 53% 15h 0% 7% 5% 4% 30% 32% 32% 24h CD11c 0% 8% 2% 2% CFSE Blander & Medzhitov supplementary

More information

SUBCLASSIFICATION OF ACUTE MYELOGENOUS LEUKEMIA PATIENTS BASED ON CHEMOKINE RESPONSIVENESS AND CONSTITUTIVE CHEMOKINE RELEASE BY

SUBCLASSIFICATION OF ACUTE MYELOGENOUS LEUKEMIA PATIENTS BASED ON CHEMOKINE RESPONSIVENESS AND CONSTITUTIVE CHEMOKINE RELEASE BY Supplementary Appendix SUBCLASSIFICATION OF ACUTE MYELOGENOUS LEUKEMIA PATIENTS BASED ON CHEMOKINE RESPONSIVENESS AND CONSTITUTIVE CHEMOKINE RELEASE BY THE LEUKEMIA CELLS Øystein Bruserud 1, Anita Ryningen

More information

The presence of T cell epitopes is important for induction of antibody

The presence of T cell epitopes is important for induction of antibody The presence of T cell epitopes is important for induction of antibody responses against antigens directed to DEC25 + dendritic cells Kelly N. S. Amorim, Eline V. Rampazo, Renan Antonialli, Marcio M. Yamamoto,

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

FIVEphoton Biochemicals

FIVEphoton Biochemicals Apo E ELISA Kit Biotin Detection Antibody Format 96T. General Protocol. FIVEphoton Biochemicals For research use only. Not for diagnostics. Part No. mapoe-biotin Use this protocol as a general guide. For

More information

Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz *

Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz * Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz * Medical Department 1, FAU Erlangen-Nuremberg, Erlangen, Germany *For correspondence: stefan.wirtz@uk-erlangen.de [Abstract] Group

More information

Gene Sequence Annealing Temperature. Actin 5 : 5 -CATCACTATTGGCAACGAGC-3 60 C 3 : 5 -ACGCAGCTCAGTAACAGTCC-3 PCR product: 410 bp

Gene Sequence Annealing Temperature. Actin 5 : 5 -CATCACTATTGGCAACGAGC-3 60 C 3 : 5 -ACGCAGCTCAGTAACAGTCC-3 PCR product: 410 bp Supporting Materials and Methods RT-PCR RT-PCR was performed as described in ref. 1 using the following oligonucleotides and PCR conditions: 2 min at 95 C, (20 s at 95 C, 20 s at the annealing temp, and

More information

Page 1 of 2. Product Information Contents: ebioscience BrdU Staining Kit for Flow Cytometry APC

Page 1 of 2. Product Information Contents: ebioscience BrdU Staining Kit for Flow Cytometry APC Page 1 of 2 ebioscience BrdU Staining Kit for Flow Cytometry APC Also known as: 5-bromodeoxyuridine RUO: For Research Use Only. Not for use in diagnostic procedures. Anti-CD3/CD28-stimulated mouse splenocytes

More information

Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2*

Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2* Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2* 1 Department of Pediatrics and Program in Immunology, Stanford University Medical

More information

Page 1 of 2. Product Information Contents: ebioscience BrdU Staining Kit for Flow Cytometry FITC

Page 1 of 2. Product Information Contents: ebioscience BrdU Staining Kit for Flow Cytometry FITC Page 1 of 2 ebioscience BrdU Staining Kit for Flow Cytometry FITC Also known as: 5-bromodeoxyuridine RUO: For Research Use Only. Not for use in diagnostic procedures. Anti-CD3/CD28-stimulated mouse splenocytes

More information

SUPPLEMENTARY WEB MATERIAL

SUPPLEMENTARY WEB MATERIAL SUPPLEMENTARY WEB MATERIAL Rapid effector memory CD8+ T cell function requires an immediate-early glycolytic switch Patrick M. Gubser 1, Glenn R. Bantug 1, Leyla Razik, Marco Fischer, Sarah Dimeloe, Gideon

More information

DA-Cell Washer and Plate for Flow Cytometry. Accelerating Life Sciences

DA-Cell Washer and Plate for Flow Cytometry. Accelerating Life Sciences DA-Cell Washer and Plate for Flow Cytometry Accelerating Life Sciences Conventional Centrifuge-based protocol for staining cells Challenges of staining cells for flow cytometry by centrifuge Losing cells

More information

Corporate Tutorial IBA T-CATCH. Cell isolation in pipette tips. ISCT, Paris Lothar Germeroth

Corporate Tutorial IBA T-CATCH. Cell isolation in pipette tips. ISCT, Paris Lothar Germeroth Corporate Tutorial IBA T-CATCH Cell isolation in pipette tips ISCT, Paris 2014 Lothar Germeroth Workshop IBA Introduction of the Streptamer technology Staining with Streptamers off rate assay T-CATCH Cell

More information

Modeling Cardiomyocyte Differentiation:

Modeling Cardiomyocyte Differentiation: icell Cardiac Progenitor Cells Prototype Application Protocol Wnt- and Activin/TGFβ-inhibitor Induction with Flow Cytometry Analysis Introduction The ability of cardiac progenitor cells to proliferate

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Real-time deformability cytometry: contour detection and theoretical modeling.

Nature Methods: doi: /nmeth Supplementary Figure 1. Real-time deformability cytometry: contour detection and theoretical modeling. Supplementary Figure 1 Real-time deformability cytometry: contour detection and theoretical modeling. (a) Image of cell deformed in constriction; contour (red) according to image analysis algorithm. Scale

More information

a Beckman Coulter Life Sciences: White Paper

a Beckman Coulter Life Sciences: White Paper a Beckman Coulter Life Sciences: White Paper Flow Cytometric Analysis of Endothelial Progenitor Cells Authors: Affiliation: Dorota Sadowicz, Vasilis Toxavidis, John Tigges Beth Israel Deaconess Medical

More information

The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The

The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM

More information

FLOW CYTOMETRY METHODS FOR IDENTIFYING MOUSE HEMATOPOIETIC STEM AND PROGENITOR CELLS

FLOW CYTOMETRY METHODS FOR IDENTIFYING MOUSE HEMATOPOIETIC STEM AND PROGENITOR CELLS TECHNICAL BULLETIN FLOW CYTOMETRY METHODS FOR IDENTIFYING MOUSE HEMATOPOIETIC STEM AND PROGENITOR CELLS Background The phenotypic characterization of mouse hematopoietic stem and progenitor cells (HSPCs),

More information

Challenges for Product Evaluation by Flow Cytometry for Cellular Therapy Product Processing Laboratories

Challenges for Product Evaluation by Flow Cytometry for Cellular Therapy Product Processing Laboratories Challenges for Product Evaluation by Flow Cytometry for Cellular Therapy Product Processing Laboratories C A R O LY N A. K E E V E R - TAY L O R, P H D M E D I C A L C O L L E G E O F W I S C O N S I N

More information

No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the

No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the APPLICATION NOTE Attune NxT Flow Cytometer No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the Attune NxT Flow Cytometer Introduction Analysis

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

IncuCyte phrodo Red Phagocytosis Assay

IncuCyte phrodo Red Phagocytosis Assay IncuCyte phrodo Red Phagocytosis Assay For quantification of phagocytosis of apoptotic and non-apoptotic cell This protocol is intended for the measurement of both apoptotic (efferocytosis) and non-apoptotic

More information

IncuCyte Phagocytosis Assay

IncuCyte Phagocytosis Assay IncuCyte Phagocytosis Assay For quantification of phagocytosis of apoptotic and non-apoptotic cell This protocol is intended for the measurement of both apoptotic (efferocytosis) and non-apoptotc phagocytosis

More information

Nanobody Library Selection by MACS

Nanobody Library Selection by MACS Nanobody Library Selection by MACS Introduction We have written the protocol below with the goal of making steps of in vitro nanobody selection as clear and broadly applicable as possible, but it is important

More information

For the removal or isolation of CD45 expressing cells via a negative or positive selection principle.

For the removal or isolation of CD45 expressing cells via a negative or positive selection principle. PlusCellect Human CD45 Kit Catalog Number PLS1430 For the removal or isolation of CD45 expressing cells via a negative or positive selection principle. This kit contains sufficient reagents for 25 tests

More information

IncuCyte Phagocytosis Assay

IncuCyte Phagocytosis Assay IncuCyte Phagocytosis Assay For quantification of phagocytosis of apoptotic and non-apoptotic cell This protocol is intended for the measurement of both apoptotic (efferocytosis) and non-apoptotc phagocytosis

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f

More information

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction March 212 Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer Contents 1 Introduction 2 Annexin V 4 JC-1 5 Caspase-3 6 APO-BrdU and APO-Direct Introduction Apoptosis (programmed

More information