Sanger sequencing troubleshooting guide. GATC Biotech AG

Size: px
Start display at page:

Download "Sanger sequencing troubleshooting guide. GATC Biotech AG"

Transcription

1 Sanger sequencing troubleshooting guide GATC Biotech AG April, 2017

2 Introduction All sequencing data generated at GATC Biotech is carefully analysed before it is delivered to the customer. In cases where issues arise with the sequencing data, we recommend using the following guide to commonly encountered problems and possible solutions. 1 Signal drops or stops abruptly Problem: A sudden drop or loss in signal is usually caused by secondary structures in the DNA. These secondary structures tend to form in GC-rich or AT-rich genomic regions. Often, the polymerase stops reading fluently in these areas, causing the appearance of short reads or no reads at all on the chromatogram. Solution: Use different primers or apply optimised sequencing protocols for secondary structures (available with SUPREMERUN) 2 Unreadable sequence after a mononucleotide stretch Problem: Sequences that contain large mononucleotide stretches could show overlapping peaks after the stretch. Whether or not the problem occurs depends on the length of the stretch and how well the primer binding works. Solution: Try sequencing with both a forward and reverse primer to cover the stretch. GATC Biotech

3 3 Presence of large peak at beginning of sequence Problem: The sequence starts with a large, unreadable signal. The following peaks appear in low intensity and the read length is often too short. This could be caused by primer dimers leading to weak primer binding or by presence of super concentrated DNA. If the DNA is in super concentrated, the template and primers could be depleted in the early cycles of the sequencing reaction, resulting in an excess of short DNA fragments. These fragments could block the capillary and inhibit the reaction flow. Solution: Reduce concentration of DNA or primer 4 Presence of dye blob on chromatogram Problem: Unincorporated dye terminators appear between positions 50 to 80 bp and are superimposed over the real peaks. The dye blobs often result from failed or impure sequencing reactions and can be affected by template concentration and quality, as well as by impurities of EDTA, salt, protein or solvents Solution: Use a primer which binds upstream of the region or check quality of template by gel electrophoresis and spectrophotometer GATC Biotech

4 5 Repetitive region in sequence Problem: Sequences with repetitive regions often show a signal decrease. Solution: Apply optimised protocol for sequencing of repetitive regions (available with SUPREMERUN) 6 High initial peak and no readable sequence Problem: Super concentrated DNA often causes high initial peaks in the chromatogram and no readable sequence afterwards. Solution: Make sure your template and primer concentrations and volumes correspond to our sample requirements. GATC Biotech

5 7 Presence of flat peaks Problem: Peaks appear flat or could blast out of range whenever the DNA concentration is too high. Solution: Make sure your template and primer concentrations and volumes correspond to our sample requirements. 8 Empty or noisy chromatogram Problem: The sequencing reaction has failed. This could be due to improper primer or template concentrations or due to primer binding issues. Solution: Perform a quality control check of your DNA by gel electrophoresis prior to sending us the samples GATC Biotech

6 9 Presence of additional small peaks / N-1 primer binding Problem: The primer is binding n-1, giving rise to small peaks underlaying the correct peaks shifted n-1. This scenario is often caused by primer degradation. Solution: Repeat sequencing with resynthesized primer. 10 Base line is highly elevated in raw data Problem: Raw data of chromatogram shows highly elevated base line. This problem could arise due to high content of salt in the sample. Solution: Use a desalting kit to further purify the DNA template before repeating the sequencing. GATC Biotech

7 11 Double sequence with two or multiple peaks in the same location Problem: The sequence starts off with good quality and then turns into a mixed sequence. This could be caused by the accidental picking of two colonies during DNA preparation, resulting in sequencing of more than one insert. Solution: Prepare a new DNA sample. 12 Mixed Template Problem: The sequence has multiple peaks in the same location from the beginning onwards. This could arise due to multiple PCR fragments being present in the reaction or if more than one primer was added per reaction. The problem could occur in cases of multiple primer binding sites on the template strand of if the PCR reaction was not cleaned well following DNA preparation. Solution: Make sure you provide only one template with one primer per sequencing run. Ensure the template you are sequencing has only one binding site for your primer of choice. Perform careful PCR purification to avoid residual salts in the reaction. GATC Biotech

8 Copyright GATC Biotech K-1478 v GATC Biotech AG European Genome and Diagnostics Centre Jakob-Stadler-Platz Konstanz Germany Tel. +49 (0) Fax +49 (0) GATC Biotech AG European Custom Sequencing Centre Gottfried-Hagen-Straße Köln Germany

Sanger Sequencing: Troubleshooting Guide

Sanger Sequencing: Troubleshooting Guide If you need help analysing your Sanger sequencing output, this guide can help. CONTENTS 1 Introduction... 2 2 Sequence Data Evaluation... 2 3 Troubleshooting... 4 3.1 Reviewing the Sequence... 4 3.1.1

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

1

1 1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

More information

Guide to Sanger Sequencing at RAMAC

Guide to Sanger Sequencing at RAMAC Guide to Sanger Sequencing at RAMAC CONTENTS 1 Introduction... 3 2 Options for your sequencing needs... 3 3 What is Sanger sequencing?... 4 4 Template preparation... 5 4.1 Plasmid template... 5 4.2 PCR

More information

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,

More information

Quick Reference Guide

Quick Reference Guide BrilliantDye Terminator v3.1 Cycle Sequencing Kit Quick Reference Guide Version: 3.0 Revision date: 23-01-2018 Product and Company Information Product name: BrilliantDye v3.1 Terminator Cycle Sequencing

More information

Sanger Sequencing Portfolio

Sanger Sequencing Portfolio Molecular Cloning Laboratories Sanger Sequencing Portfolio Significant Cost Savings vs ABI Uncompromised Performance Longer Read Length Longer Shelf Life No Recalibrations Necessary PAGE 1 BrightDye Terminator

More information

Tips DNA Sequencing (Revision Date: 09 July 2007)

Tips DNA Sequencing (Revision Date: 09 July 2007) Tips DNA Sequencing (Revision Date: 09 July 2007) 1. PCR product: clone, or directly sequence? 2. How do I clean DNA template for sequencing? 3. How much DNA should I use in a sequencing reaction? 4. Why

More information

2. Pyrosequencing Assay Design

2. Pyrosequencing Assay Design 2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

Guide to Sanger Sequencing at RAMAC

Guide to Sanger Sequencing at RAMAC Guide to Sanger Sequencing at RAMAC CONTENTS 1 Introduction... 3 2 Options for your sequencing needs... 3 3 What is Sanger sequencing?... 4 4 Template preparation... 5 4.1 Plasmid template... 5 4.2 PCR

More information

Bead Type (NaI) Gel Extraction Kits

Bead Type (NaI) Gel Extraction Kits Bead Type (NaI) Contents Kit Contents Principle Important Notes Bead Type (NaI) Gel Extraction Kit Protocol Troubleshooting Guide 2 3 3 4 5 Ordering Information 6 Kit Contents Catalog No. Number of preparations

More information

7. Troubleshooting Guidelines

7. Troubleshooting Guidelines 7. Troubleshooting Guidelines The Pyrosequencing TM technique provides the user with sequence information for several nucleotides 3 of the sequencing primer apart from the polymorphic site. This gives

More information

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre FEBRUARY 28, Version 3.5

SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre FEBRUARY 28, Version 3.5 FEBRUARY 28, 2018 SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre Sanger Sequencing User Guide Version 3.5 Copyright 2010 McGill University and Génome Québec Innovation Centre

More information

Gene-Spin DNA Purification Kit - V3

Gene-Spin DNA Purification Kit - V3 Protech Technology 波仕特生物科技 Gene-Spin 1-4-3 DNA Purification Kit - V3 (For PCR/DNA clean-up & Gel Extraction) Innovative Tools for Nucleic Acid Purification This Kit is for research purposes only. Not for

More information

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Lab Book igem Stockholm Lysostaphin. Week 6

Lab Book igem Stockholm Lysostaphin. Week 6 Lysostaphin Week 6 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

AxyPrep PCR Clean-up Kit AxyPrep-96 PCR Clean-up Kit

AxyPrep PCR Clean-up Kit AxyPrep-96 PCR Clean-up Kit AxyPrep PCR Clean-up Kit AxyPrep-96 PCR Clean-up Kit For the purification of amplicons from PCRs Kit contents, storage and stability AxyPrep PCR Clean-up Kit Cat. No. AP-PCR-4 AP-PCR-50 AP-PCR-250 Kit

More information

PlantDirect TM Multiplex PCR System

PlantDirect TM Multiplex PCR System PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Tips for sequencing DNA

Tips for sequencing DNA Sequencing tips and trouble shooting from website http://www.nucleics.com/dna_sequencing_support/dna-sequencing-protocol-tips.html Tips for sequencing DNA Use clean DNA The cleanliness of the DNA is the

More information

Generation of gene knockout vectors for Dictyostelium discoideum

Generation of gene knockout vectors for Dictyostelium discoideum Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

7 Synthesizing the ykkcd Mutant Toxin Sensor RNA in vitro

7 Synthesizing the ykkcd Mutant Toxin Sensor RNA in vitro 7 Synthesizing the ykkcd Mutant Toxin Sensor RNA in vitro 7.1 Learning Objective In the quest toward understanding how the ykkcd toxin sensor recognizes the antibiotic tetracycline you thus far designed

More information

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Size-Select Kit for NGS Library Preparation Product # 53600

Size-Select Kit for NGS Library Preparation Product # 53600 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Size-Select Kit for NGS Library Preparation Product # 53600 Product

More information

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double

More information

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

GENOMICS RESEARCH LABORATORY Sample Submission Requirements

GENOMICS RESEARCH LABORATORY Sample Submission Requirements Sanger Sequencing GENOMICS RESEARCH LABORATORY Sample Submission Requirements The quality of the starting template is the key factor in the quality of DNA sequence data. Sequencing by capillary electrophoresis

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Large DNA Fragments Extraction Kit

Large DNA Fragments Extraction Kit Instruction Manual Ver. 04.25.17 For Research Use Only Large DNA Fragments Extraction Kit DFL004 (4 Preparation Sample Kit) DFL100 (100 Preparation Kit) DFL300 (300 Preparation Kit) Advantages Efficient:

More information

Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog # reactions

Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog # reactions Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog #8958 100 reactions Product Description Telomeres are repetitive nucleotide elements at

More information

Sequencing Order Form (Kindly send the order form along with the samples)

Sequencing Order Form (Kindly send the order form along with the samples) Sequencing Order Form (Kindly send the order form along with the samples) Bioserve Biotechnologies (I) Pvt. Ltd. Date: From: Billing Address: Distributer Details: Name: Address: Bill To: Address: Name:

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Quantum Prep PCR Kleen Spin Columns

Quantum Prep PCR Kleen Spin Columns Quantum Prep PCR Kleen Spin Columns Catalog Numbers 732-6300 (25 pack) 732-6301 (100 pack) Bio-Rad Laboratories, 2000 Alfred Nobel Drive, Hercules, CA 94547 4006142 Rev B Table of Contents Section 1 Introduction...

More information

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace molecular biology Marketplace MOLECULAR BIOLOGY GREATEST HITS Special offers on Thermo Scientific products: Cloning kits Restriction and modifying enzymes IPTG and X-Gal DNA ladders Agarose tablets Nucleic

More information

SunScript TM One Step RT-qPCR Kit

SunScript TM One Step RT-qPCR Kit INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting

More information

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

Mini SAL Salivary DNA Isolation Kit (Spin Column Method)

Mini SAL Salivary DNA Isolation Kit (Spin Column Method) Mini SAL Salivary DNA Isolation Kit (Spin Column Method) Catalog No. DNAX-504-30 Oasis Diagnostics Corporation - Pioneering Oral Fluid Diagnostic Solutions TABLE OF CONTENTS Storage, Stability & Intended

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1 Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA

More information

Hurricane Miniprep Kit PROTOCOL

Hurricane Miniprep Kit PROTOCOL Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The

More information

FastFire qpcr PreMix (Probe)

FastFire qpcr PreMix (Probe) FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr

More information

Fungal rdna (D1/D2) PCR Kit Fast

Fungal rdna (D1/D2) PCR Kit Fast Cat. # RR184A For Research Use Fungal rdna (D1/D2) PCR Kit Fast Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V.

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

Bacterial 16S rdna PCR Kit Fast (800)

Bacterial 16S rdna PCR Kit Fast (800) Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

SeCore SBT Sequence Based Typing

SeCore SBT Sequence Based Typing MOLECULAR TYPING Product Brochure SeCore SBT Sequence Based Typing Key Benefits SeCore HLA typing kits combine the accuracy of bidirectional sequencing and the power and flexibility of our improved sequence

More information

THUNDERBIRD SYBR qpcr Mix

THUNDERBIRD SYBR qpcr Mix Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]

More information

Session 7 Glycerol Stocks & Sequencing Clones

Session 7 Glycerol Stocks & Sequencing Clones Session 7 Glycerol Stocks & Sequencing Clones Learning Objective: In this lab you will prepare several of your clones for DNA sequencing and make glycerol stock cultures as a stable and uniform starting

More information

GenepHlow Gel Extraction Kit

GenepHlow Gel Extraction Kit Instruction Manual Ver. 02.10.17 For Research Use Only GenepHlow Gel Extraction Kit DFG004 (4 Preparation Sample Kit) DFG100 (100 Preparation Kit) DFG300 (300 Preparation Kit) Advantages Convenient: includes

More information

Lab Book igem Stockholm Lysostaphin. Week 8

Lab Book igem Stockholm Lysostaphin. Week 8 Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

APPLICATION INFORMATION

APPLICATION INFORMATION APPLICATION INFORMATION HIGH RESOLUTION HLA TYPING USING THE PROTRANS S4 SBT KIT AND THE GENOMELAB CEQ OR GEXP GENETIC ANALYSIS SYSTEMS GenomeLab CEQ and GeXP Genetic Analysis Systems Jim Thorn PhD and

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

EZ-10 SPIN COLUMN HANDBOOK

EZ-10 SPIN COLUMN HANDBOOK EZ-0 SPIN COLUMN HANDBOOK EZ-0 Spin Column Plasmid DNA Mini Kit EZ-0 Spin Column PCR Products Purification Kit EZ-0 Spin Column DNA Gel Extraction Kit Version 20.0 Rev 3/23/205 ISO900 Certified 20 Konrad

More information

Isolation of genomic DNA from buccal swabs - a brief protocol. Assessment of DNA concentration and purity

Isolation of genomic DNA from buccal swabs - a brief protocol. Assessment of DNA concentration and purity Molecular biology 1 DNA Isolation Isolation of genomic DNA from buccal swabs - a brief protocol MACHEREY-NAGEL isolation kit Protocol: 1. Gently rub and rotate swab along the inside of the cheek (both

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

TECH NOTE Ligation-Free ChIP-Seq Library Preparation

TECH NOTE Ligation-Free ChIP-Seq Library Preparation TECH NOTE Ligation-Free ChIP-Seq Library Preparation The DNA SMART ChIP-Seq Kit Ligation-free template switching technology: Minimize sample handling in a single-tube workflow >> Simplified protocol with

More information

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation

More information

SunScript One Step RT-PCR Kit

SunScript One Step RT-PCR Kit SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...

More information

Nextera DNA Sample Prep Kit (Roche FLX-compatible)

Nextera DNA Sample Prep Kit (Roche FLX-compatible) Cat. Nos. FL09115, FL091120, and FLBC0950 The is designed to prepare genomic DNA libraries compatible with the Roche 454 Genome Sequencer FLX System, with standard FLX chemistry. Nextera technology* employs

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

KAPA HiFi HotStart ReadyMix PCR Kit

KAPA HiFi HotStart ReadyMix PCR Kit KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,

More information

PowerSoil DNA Isolation Kit

PowerSoil DNA Isolation Kit PowerSoil DNA Isolation Kit Catalog No. Quantity 12888-50 50 Preps 12888-100 100 Preps Instruction Manual Introduction The PowerSoil DNA Isolation Kit* is comprised of a novel and proprietary method for

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>> BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003)

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003) EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP-10002 & EP-10003) INSTRUCTION MANUAL *These products are designed and sold for use in the Polymerase Chain Reaction (PCR)

More information

Next Generation Polymerase Chain Reaction

Next Generation Polymerase Chain Reaction Next Generation Polymerase Chain Reaction Developed by Nobel laureate Kary Mullis in the 1980s, Polymerase Chain Reaction (PCR) is a molecular technology that allows fast and in vitro. It has since become

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

PCR Amplifies Targeted Sequence

PCR Amplifies Targeted Sequence PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for

More information

Interpretation of sequence results

Interpretation of sequence results Interpretation of sequence results An overview on DNA sequencing: DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It use a modified PCR reaction where both

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:

More information

Guidelines for Preparing 20 kb SMRTbell Templates

Guidelines for Preparing 20 kb SMRTbell Templates Guidelines for Preparing 20 kb SMRTbell Templates User Bulletin This Bulletin provides recommendations and tips for preparing 20 kb SMRTbell templates using the BluePippin size-selection method. Once you

More information

FastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O

FastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O Products for PCR www.nippongenetics.eu efficiency polymerase convenience endpoint PCR incl. loading dye direct PCR incl. dntps engineered enzyme archeal type B polymerase high GC content FastGene tissuebest

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

PowerMax Soil DNA Isolation Kit

PowerMax Soil DNA Isolation Kit PowerMax Soil DNA Isolation Kit Catalog No. Quantity 12988-10 10 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the

More information

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information