Protein Synthesis

Transcription

1 HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is uracil and it is complementary to adenine whenever RNA base-pairs with another nucleic acid Explain that the purpose of transcription is to transfer the instructions for making a protein from a gene to an RNA molecule Using models of DNA and RNA, explain the process of transcription RNA polymerase, an enzyme that adds and links complementary RNA nucleotides, binds to a gene s promotera specific sequence of DNA that acts as a start signal RNA polymerase unwinds and separates the two strands of the double helix of DNA, exposing the nucleotides on each strand RNA polymerase adds and links complementary RNA nucleotides as it reads the gene. RNA polymerase moves along the nucleotides of the DNA following the base-pair rules for DNA replication, except that uracil, rather than thymine, pairs with adenine. Transcription proceeds until RNA polymerase reaches a stop signal in the DNA When the RNA nucleotides are added, they are linked together with covalent bonds As RNA polymerase moves down the strand, a single strand of RNA grows and the two strands of DNA close up forming hydrogen bonds between complementary bases, reforming the double helix Explain that the purpose of translation is to read the instructions on the RNA molecule and put together the amino acids that make up the protein Identify codons as a series of three-nucleotide sequences on mrna that corresponds to an amino acid Identify transfer RNA (trna) as single strands of RNA that carry a specific amino acid on one end and an anticodon, a three-nucleotide sequence that is complementary to an mrna codon Identify ribosomal RNA (rrna) as RNA molecules that are part of the structure of ribosomes Using models of DNA and RNA, explain the process of translation translation begins when mrna leaves the nucleus, enters the cytoplasm, and attaches to a ribosome At the beginning of each protein is the universal start codon, AUG, which tells the ribosome to start translating trna carries a specific amino acid to the ribosome and its anticodon matches up to the codon on mrna As the trna line up, the amino acids they carry, bond together to form a protein polymer and the trna is released There are three stop codons (UAA, UAG, and UGA) which when reached, tell the ribosome to stop translating the protein Terminology Ribonucleic acid (RNA) RNA polymerase Anticodon repressor Read a codon chart and determine which amino acids corresponds with the three letter code Recognize that these nitrogen bases and all of their combinations are the genetic code (codons) and are common to all organisms. Recognize that only a fraction of the genes in a cell are expressed at any given time. An expressed gene is a gene that is transcribed into RNA Understand that gene expression is a regulated process in which genes can be turned on (expressed) or off (not expressed). Identify and illustrate DNA mutations Uracil Messenger RNA ribosomal DNA Point mutation Transcription Codon Operator Gene rearrangement Translation Genetic code Operon Frame-shift mutation Gene expression Transfer RNA Lac operon Intron Gene alterations Insertion mutation Deletion mutation Exon Polypeptides 1 Protein Synthesis - Simmons CRE 11/14

2 HEBISD Gene rearrangement-an entire gene is moved to a new location Transposition Chromosomal rearrangement-occurs during meiosis Gene alterations Point mutation - a single nucleotide changes Insertion mutation-a sizeable length of DNA is inserted into a gene Deletion mutation-segments of a gene are lost; often during meiosis Frame-shift mutation- a mutation that causes a gene to be read in the wrong three-nucleotide sequence Evaluate the significance of these mutations Mutations affect the translation of the codons because the order of the nucleotides has been change. This causes the gene to not function normally and could lead to genetic disorders Depending on how a mutation is translated, it can result in no change in the resulting protein, an insignificant change or one that may be crucial for life. Because several different codons result in the same amino acid, some mutations do not result in a different protein being produced. As a result some mutations are silent, as they are not expressed. In some instances, the mutation may result in proteins that enhance an organism s ability to survive and reproduce. More often, a mutation is detrimental to the organism. Mutations which involve a deletion or insertion often have disastrous effects. By changing one letter in the sequence, the series of codons will be changed resulting in the translation of very different proteins. Mutations result in the diversity of genes in the world, which makes natural selection and evolution possible. Unit Summaries: pgs RNA and Protein Synthesis In order for a gene to work, the genetic instructions in the DNA molecule must be decoded. The first step is to copy the DNA sequence into RNA. RNA makes it possible for a single gene in a DNA molecule to make hundreds of copies. RNA has a structure like DNA, except for three differences. The sugar in RNA is ribose instead of Deoxyribose. RNA is single-stranded. RNA has uracil in place of thymine. There are three kinds of RNA molecules work together to make proteins: 1. Messenger RNA has the instructions to put together amino acids to make a protein. Proteins are put together on ribosomes. 2. Ribosomes are made up of proteins and ribosomal RNA. 3. Transfer RNA carries each amino acid to the ribosome according to the coded message in messenger RNA. RNA is copied from DNA in a process called transcription. The enzyme RNA polymerase binds to DNA and separates the two strands. Then RNA polymerase builds a strand of RNA using one strand of DNA as the template. The sequence of DNA that signals RNA polymerase where to bind and start making RNA is called the promoter. The instructions for making proteins are found in the order of the four nitrogenous bases. This code is read three letters, or nucleotides, at a time. Each codon, or group of three nucleotides, specifies a certain amino acid that makes up a protein. In the genetic code, some amino acids are specified by more than one codon. One codon is a start signal for translation. Three codons signal the end of a protein. Translation is the process in which the genetic code in RNA is used to make proteins. Translation takes place on ribosomes. Before translation can begin, messenger RNA is transcribed from DNA. Then the messenger RNA moves into the cytoplasm and attaches to a ribosome. As each codon of the messenger RNA moves through the ribosome, the proper amino acid is brought into the ribosome by transfer RNA. The ribosome joins together each amino 2 Protein Synthesis - Simmons CRE 11/14

3 HEBISD acid. In this way, the protein chain grows. When the ribosome reaches a stop codon, it falls away from the protein chain and the messenger RNA molecule. Transcription has ended Mutations Mutations are changes in the sequence of DNA. Gene mutations are changes in a single gene. Chromosomal mutations cause changes in whole chromosomes. Gene mutations that occur at a single point in the DNA sequence are called point mutations. When a point mutation causes one base to replace another, only one amino acid is affected. If a nucleotide is added or taken away, it causes a frame-shift mutation. All the groupings of three nucleotides, or codons, are changed. This can cause the gene to produce a completely different protein. In a chromosomal mutation, there is a change in the number or the structure of chromosomes. There are four kinds of chromosomal mutations: deletions, duplications, inversions, and translocations Gene Regulation Genes can be turned on and off when proteins are needed. In prokaryotes, some genes are turned on and off by a section of a chromosome called an operon. An operon is a group of genes that work together. Two sequences of DNA in the operon that control when genes are turned on and off are the operator and the promoter. When the cell needs a certain protein, RNA polymerase attaches to the promoter and produces a messenger RNA that is translated into the needed protein. When the cell no longer needs the protein, it makes another special protein called the repressor. The repressor attaches to the operator, blocking the promoter so that RNA polymerase cannot attach to it. This turns the genes of the operon off. In eukaryotes, there are several ways of turning genes on and off. One system uses a protein that binds directly to DNA. This either starts or increases the transcription of certain genes. DNA Review DNA contains genes: sequences of nucleotide bases (Adenine, Guanine, Cytosine, & Thymine) that codes for specific traits These Genes code for polypeptides (chains of amino acids known as proteins) Proteins are used to build cells and do much of the work inside cells Genes and Proteins: Proteins are made of amino acids linked together by peptide bonds 20 different amino acids exist Amino Acids: Amino acid chains are called polypeptides How does Protein Synthesis Start? DNA 3 Protein Synthesis - Simmons CRE 11/14

4 HEBISD DNA is found inside the nucleus Proteins, however, are made in the cytosol of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER DNA s code must be copied and taken to the cytosol In the cytosol, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called Protein Synthesis RNA Ribonucleic Acid Roles of DNA & RNA DNA is the master plan, while DNA has a sugar - Deoxyribose DNA has thymine (T) DNA is double-stranded Three Types of RNA: RNA is the blueprint for the Master Plan RNA has a sugar - Ribose RNA contains the base uracil (U) RNA molecule is single-stranded Messenger RNA (mrna): copies DNA s code & carries the genetic information to the ribosomes Ribosomal RNA (rrna): along with protein, makes up the ribosomes 4 Protein Synthesis - Simmons CRE 11/14

5 HEBISD Transfer RNA (trna): transfers amino acids to the ribosomes where proteins are synthesized Messenger RNA (mrna) in Detail: Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T ) Carries the information for a specific protein Made up of 500 to 1000 nucleotides long Sequence of 3 bases called codon AUG methionine or start codon UAA, UAG, or UGA stop codons The Genetic Code: A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating Use the code by reading from the inside toward the outside ring Example: AUG codes for Methionine Several Amino Acids have multiple codons Ribosomal RNA (rrna) in Detail: rrna is a single strand 100 to 3000 nucleotides long Globular in shape Made inside the nucleus of a cell Associates with proteins to form ribosomes Site of Protein Synthesis 5 Protein Synthesis - Simmons CRE 11/14

6 HEBISD Transfer RNA (trna) in Detail: Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon The Pathway to Protein Synthesis Transcription The process of copying the sequence of one strand of DNA, the template strand mrna copies the template strand Requires the enzyme RNA Polymerase During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box The termination signal are specific base sequences act as signals to stop Only one of the two DNA strands is transcribed. This strand is called the template strand, because it provides the template for ordering the sequence of nucleotides in an RNA transcript. The other strand is called the coding strand. The DNA template strand is read 3' 5' direction by RNA polymerase and the new RNA strand is synthesized in the 5' 3' direction. 6 Protein Synthesis - Simmons CRE 11/14

7 HEBISD New mrna Processing: After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5 end of the newly copied mrna A poly A tail is added to the 3 end of the RNA The newly processed mrna can then leave the nucleus mrna leaves the nucleus through its pores and goes to the ribosomes Translation Translation is the process of decoding the mrna into a polypeptide chain Ribosomes read mrna three bases or 1 codon at a time and construct the proteins Made of a large and small subunit Composed of rrna (40%) and proteins (60%) Have two sites for trna attachment: P site and A site Stage 1: Initiation mrna transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit 7 Protein Synthesis - Simmons CRE 11/14

8 HEBISD The Process: 8 Protein Synthesis - Simmons CRE 11/14

9 HEBISD The End Product The Protein: The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds Summary of mrna to a Protein Central Dogma of Genetics: Within each cell the genetic information flows from DNA RNA Protein. This flow of information is unidirectional and irreversible. The information carried within the DNA dictates the end product (protein) that will be synthesized. This information is the genetic code. Conversion of DNA encoded information to RNA is called transcription. The information from a mrna is then translated to an amino acid sequence in the corresponding protein 9 Protein Synthesis - Simmons CRE 11/14

10 HEBISD Mutation: A gene mutation is a permanent change in the DNA sequence that makes up a gene. Mutations range in size from a single DNA building block (DNA base) to a large segment of a chromosome. Gene mutations occur in two ways: they can be inherited from a parent or acquired during a person s lifetime. Mutations that are passed from parent to child are called hereditary mutations or germ-line mutations (because they are present in the egg and sperm cells, which are also called germ cells). This type of mutation is present throughout a person s life in virtually every cell in the body. Mutations that occur only in an egg or sperm cell, or those that occur just after fertilization, are called new (de novo) mutations. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell, but has no family history of the disorder. Acquired (or somatic) mutations occur in the DNA of individual cells at some time during a person s life. These changes can be caused by environmental factors such as ultraviolet radiation from the sun, or can occur if a mistake is made as DNA copies itself during cell division. Acquired mutations in somatic cells (cells other than sperm and egg cells) cannot be passed on to the next generation. Mutations may also occur in a single cell within an early embryo. As all the cells divide during growth and development, the individual will have some cells with the mutation and some cells without the genetic change. This situation is called mosaicism. Some genetic changes are very rare; others are common in the population. Genetic changes that occur in more than 1 percent of the population are called polymorphisms. They are common enough to be considered a normal variation in the DNA. Polymorphisms are responsible for many of the normal differences between people such as eye color, hair color, and blood type. Although many polymorphisms have no negative effects on a person s health, some of these variations may influence the risk of developing certain disorders. Types of Mutations: Substitution (Missense) mutation This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by a gene. Termination (Nonsense) mutation A nonsense mutation is also a change in one DNA base pair. Instead of substituting one amino acid for another, however, the altered DNA sequence prematurely signals the cell to stop building a protein. This type of mutation results in a shortened protein that may function improperly or not at all. 10 Protein Synthesis - Simmons CRE 11/14

11 HEBISD Insertion An insertion changes the number of DNA bases in a gene by adding a piece of DNA. As a result, the protein made by the gene may not function properly. Deletion A deletion changes the number of DNA bases by removing a piece of DNA. Small deletions may remove one or a few base pairs within a gene, while larger deletions can remove an entire gene or several neighboring genes. The deleted DNA may alter the function of the resulting protein(s). Duplication A duplication consists of a piece of DNA that is abnormally copied one or more times. This type of mutation may alter the function of the resulting protein. Frame-shift mutation This type of mutation occurs when the addition or loss of DNA bases changes a gene s reading frame. A reading frame consists of groups of 3 bases that each code for one amino acid. A frame-shift mutation shifts the grouping of these bases and changes the code for amino acids. The resulting protein is usually nonfunctional. Insertions, deletions, and duplications can all be frame-shift mutations. 11 Protein Synthesis - Simmons CRE 11/14

12 HEBISD Concept Review: 6. The DNA molecule is in the shape of a(n) The mrna Molecule is in the shape of a(n) a. Single strand b. Alpha helix c. Beta pleated sheet d. Double helix 1. In the above item A refers to the 2. In the above item B refers to the 3. In the above item C refers to the 4. The sugar molecule represented consists of Carbons. 5. The above nucleotide is a purine or pyrimidine? 8. The Backbone of the DNA molecule is made of which components of the nucleotide from the above diagram? a. A & B b. B & C c. A & C d. B only 9. The component which binds complimentarily according to base pairing rules is item. a. A b. B c. C d. None of the above 10. According to base pairing rules with DNA "A" bonds only to a. A b. C c. T d. U e. G 11. The "Central Dogma" of genetics states the usual order of events in protein synthesis proceeds along which of the following sequence? Matching: Directions: Match the enzyme with the correct function of that enzyme 12. DNA Helicase: 13. RNA polymerase: 14. Primase: 15. DNA polymerase: 12 Protein Synthesis - Simmons CRE 11/14

13 HEBISD 16. Ligase: A. Binds RNA primer to lagging strand of DNA B. "Unzips" DNA strand C. Adds deoxyribo-nucleotides along a DNA strand D. Adds ribo-nucleotides along an RNA strand E. Links DNA fragments on lagging strand 17. The above diagram refers to a molecule of 18. Item labeled A refers to 19. Item labeled B refers to 20. Given the above DNA strand. If replication was proceeding from bottom to top, which strand would be the "lagging" Strand? Why? 21. Large ribosomal subunit 22. Ribosome 23. mrna strand 24. Polypeptide 25. Small subunit 13 Protein Synthesis - Simmons CRE 11/14

14 HEBISD 26. The ribosomes are made in which cellular structure in the eukaryotic cell. 27. The DNA strand from which mrna is transcribed is known as the RNA molecules differ from DNA in the following ways except 29. The three base pair sequence found on an mrna strand is called the DNA replication occurs in which direction? 31. A mutation which results in the changing of all the codons following the error is called a mutation. Using the Following Diagram, complete the questions below: DNA Sequence: TACCCCATTTAACATACCACT 32. Complimentary DNA strand? 33. mrna Strand? 34. Polypeptide Sequence? 14 Protein Synthesis - Simmons CRE 11/14