Nucleofector technology and transient protein production
|
|
- Teresa Hill
- 6 years ago
- Views:
Transcription
1 amaxa xxxxxxxxxxxx Nucleofector technology research Nucleofector technology and transient protein production your link to transfection
2 The Nucleofector technology and transient protein production Transient protein expression systems have gained increasing relevance as they enable fast and flexible protein production. Protein amounts up to mg can be produced within a few days in contrast to production periods up to several months using stably transfected cell clones. Transient protein production offers: fast production of small scale protein amounts low costs for cell maintenance Easy and fast nucleofection procedure: harvest of protein Combine cells of interest, expression vector and the appropriate celltype specific Nucleofector Solution and transfer to an amaxa certified cuvette. Insert the cuvette into the Nucleofector and choose the cell-type specific Nucleofector program. Press the start button X. After a few seconds nucleofection is completed. Rinse the cuvette with culture medium and transfer the cells into the culture flask. For 1 x 8 cells, ten cuvettes have to be nucleofected. Culture cells for several days. In the past gene transfer into serum-free cultivated mammalian cells suitable for protein production was hampered by inefficient transfection methods. The Nucleofector technology represents the ideal tool for gene transfer even into hard-to-transfect cell lines like suspension CHO cells. It has now been successfully tested and validated for its use in transient protein production. Benefit from transient protein production using nucleofection: suitable for scho, shek-293, BHK-21, NS and many other cells applicable even under serum-free conditions high transfection efficiencies low DNA amounts page 2 Nucleofector technology
3 Nucleofection is superior to lipofection for transient protein production In a comparative study the Nucleofector technology (amaxa) and the lipofection reagent Lipofectamine 2 (Invitrogen) have been tested in regard to their suitability for transient protein production. Nucleofection achieves -3 times higher expression rates in CHO cells compared to cells transfected with lipofection. A similar ratio has been determined for both the specific and the volumetric productivities. Experimental setup: 2 different suspension CHO cell clones have been transfected with a plasmid encoding the human secreted alkaline phosphatase (SEAP) either using Lipofectamine 2 (Invitrogen) or nucleofection. Transfection conditions: Cell line scho-clone1 (ECACC) scho-clone2 (Invitrogen) Transfection method Lipofectamine 2 nucleofection Lipofectamine 2 nucleofection Transfection conditions 29 µl Cell Line Kit V Program U µl Cell Line Kit V Program U-24 DNA 58 µg 25 µg 116 µg 25 µg Cell number 5 x 7 5 x 7 5 x 7 5 x 7 Post transfection cells were cultivated as batches in spinner flasks containing 5 ml culture medium for 5 days under non-regulated conditions. Suspension HEK-293 cells (DSMZ, adapted from adherent cell clone) have also been tested successfully. 5 x 7 cells have been nucleofected with 25 µg pdrive-hseap using Cell Line Nucleofector Kit V in combination with program X-1. A specific productivity of 2.4 µu/c/d and a volumetric productivity of.5 U/ml could be obtained. These cells were not transfectable using lipofection. Specific productivities (µunits/cell/ day) of hseap referred to a cell density of 6 cells/ml seeded after the respective transfection. specific productivity hseap [µu/c/d] lipofection nucleofection scho-clone1 scho-clone2 page 3 Nucleofector technology
4 Volumetric productivities (Units/ml) of hseap. volumetric productivity hseap [U/ml] scho-clone1, lipofection scho-clone1, nucleofection scho-clone2, lipofection scho-clone2, nucleofection time [d] Efficient antibody production using nucleofection The Nucleofector technology was also tested successfully for its suitability to produce functional proteins. 1.7 mg of a human IgG1 antibody was produced within five days. antibody concentration [µg/ml] time [d] Antibody production after nucleofection of CHO suspension cells 1 x 8 scho cells (clone 2, ^= samples) were nucleofected using Cell Line Nucleofector Kit V in combination with program U-24 or U-24. Cells were cotransfected with plasmids encoding either the DNA sequence of the light chain or the heavy chain of a human IgG1 antibody. Post nucleofection cells were cultivated for 5 days in 5 ml serum-free medium. Cells reached a specific productivity of 5.5 pg/c/d and a volumetric productivity of 39 µg/ml. Within 4-5 days 1.7 mg of the antibody could be produced (determined by ELISA). The integrity of the produced antibody was verified via Western blotting. q For more scientific data go to or contact our Scientific Support Team. page 4 Nucleofector technology
5 High transfection efficiencies in hard-to-transfect cells such as scho and shek-293 CHO cells are the predominant cell line used for protein production. Suspension CHO cells have so far been difficult to transfect by conventional non-viral methods. The same is true for many other suspension cell lines used for protein production like BHK-21 and NS. High transfection efficiencies after nucleofection. Transfection efficiencies for two different suspension CHO cell clones and two different suspension HEK- 293 cell clones after nucleofection of pmaxgfp. maxgfp positive cells were determined 24h post nucleofection by FACS analysis (light bars). Viabilities were assessed after propidium iodide staining by FACS analysis (dark bars). transfection efficiency/viability (%) efficiency viability scho-clone1 scho-clone2 shek-293-clone1 shek-293-clone2 How to find your cell line of interest The Nucleofector technology is the ideal tool for efficient non-viral gene transfer into different suspension CHO and HEK-293 cell clones. Please find the Optimized Protocols for these and many other cell lines on amaxa s homepage. Visit the amaxa online cell line database Enter your cell line of interest or view complete list Your cell line of interest Screen results Cell type listed Cell type not listed Click on cell name Use recommended Nucleofector Kit in combination with the respective Optimized Protocol or use the settings optimized by other users. Use Cell Line Optimization Nucleofector Kit or contact amaxa s Scientific Support Team for further advice. page 5 Nucleofector technology
6 How Nucleofector technology works The Nucleofector Device delivers unique electrical parameters that are different from any commercially available electroporation device. The electrical settings are pre-programmed and each program is optimized for the requirements of a particular cell type and can be used for the delivery of different substrates such as sirna duplexes, DNA vectors or RNA. The Nucleofector Kits contain amaxa specified cuvettes, pipettes, Nucleofector Solution, Supplement and the positive control vector pmaxgfp. For cell lines, three different Nucleofector Solutions, R, T and V, are available. All solutions provide a cellfriendly environment that ensure the highest transfection results and cell viability. Nucleofector Kits are only functional in combination with the Nucleofector Device. Ordering information Nucleofector Kits for cell lines* VCO-1 VCA-1 VCA-2 VCA-3 Cell Line Optimization Nucleofector Kit Cell Line Kit R Cell Line Kit T Cell Line Kit V d For an up-to-date overview or more detailed information about amaxa products, please see * Each Kit contains Nucleofector Solution, Supplement, Cuvettes and Pipettes for 25 reactions and the pmaxgfp plasmid as a positive control. VCO-1 contains Nucleofector Solution, Supplement, Cuvettes and Pipettes for 5 reactions and the pmaxgfp plasmid as a positive control. WKB-2_5.25 amaxa s Nucleofector Process, Nucleofector Device and Nucleofector Solutions are covered by PCT Applications PCT/EP1/7348, PCT/DE2/1489, PCT/DE2/1483, and other pending patents, and domestic or foreign applications corresponding thereto. amaxa, Nucleofector, nucleofection and maxgfp are trademarks of amaxa GmbH. Lipofectamine 2 is a trademark of Invitrogen. amaxa GmbH, Europe/World amaxa Inc., USA Scientific Support Scientific Support +49 () (24) scientific-support@amaxa.com scientific-support.us@amaxa.com
Cell Line Nucleofector Kit V
page 1 of 7 Cell Line Nucleofector Kit V for THP-1 Cells [ATCC] Cell type Origin Human accute monocyte leukemia cell line [ATCC TIB-202 frozen vial]. Morphology Monocyte % transfection efficiency 80 70
More informationGeneral Protocol. General Protocol for nucleofection of suspension cell lines
page 1 of 7 General Protocol for nucleofection of suspension cell lines Chapter Contents 1 Procedure outline & important advice 2 Optimization guidelines 3 Experimental set-up 4 Protocol 4.1 Cell culture
More informationCell Line Nucleofector Kit V
page 1 of 7 Cell Line Nucleofector Kit V for PC-3 cells [ATCC] Cell type Origin Human prostate adenocarcinoma [ATCC] (Cat.No. CRL-1435; frozen vial). Morphology Epithelial cells. Example of nucleofection
More informationEstablishing sirna assays in primary human peripheral blood lymphocytes
page 1 of 7 Establishing sirna assays in primary human peripheral blood lymphocytes This protocol is designed to establish sirna assays in primary human peripheral blood lymphocytes using the Nucleofector
More informationAmaxa Cell Line 96-well Nucleofector Kit SF
Amaxa Cell Line 96-well Nucleofector Kit SF For HepG2 Human hepatocellular carcinoma; adherent epithelial cells Example for Nucleofection of HepG2 cells OD 405 100 80 SEAP activity % 100 80 Transfection
More informationAmaxa Cell Line Nucleofector Kit L
Amaxa Cell Line Nucleofector Kit L For 3T3-L1 (adipocytes) [ATCC CL-173, cryopreserved] Mouse embryonal fibroblast, differentiated into adipocytes; Fibroblast-like cells before differentiation; adipocyte-like
More informationHYPE-CHO Transfection Kit Results
HYPE-CHO Transfection Kit Results HYPE-CHO Transfection Kit is the newest reagent dedicated to achieve High Yield Protein Expression in CHO cells. This kit has been designed for maximum efficiency in CHO
More informationGeneral Protocol. Optimized Protocol
page 1 of 9 General Protocol for 96-well nucleofection of suspension cell lines Chapter Contents 1 Procedure outline & important advice 2 Product description 3 Protocol 3.1 Cell culture 3.2 Required material
More informationAmaxa 96-well Shuttle Basic Protocol for Primary Mammalian Smooth Muscle Cells (SMC)
Amaxa 96-well Shuttle Basic Protocol for Primary Mammalian Smooth Muscle Cells (SMC) Cell Description Cells derived from mammalian smooth muscle cell tissues from various organs; adherent long tapering
More informationAmaxa 96-well Shuttle Protocol for Primary Cell Optimization
For use with plasmid DNA and/or sirna The Primary Cell Optimization Protocol enables you to optimize 96-well Shuttle Conditions for a primary cell of your choice using our Primary Cell Optimization 96-well
More informationAmaxa Cell Line 96-well Nucleofector Kit SF
Amaxa Cell Line 96-well Nucleofector Kit SF For HL-60 Human acute promyelocytic leukemia; myeloblastic cells Example for Nucleofection of HL-60 cells % 100 Transfection efficiency % 100 Transfection efficiency
More informationNEW! CHOgro Expression System
NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with
More informationTransIT-PRO Transfection Kit Protocol for MIR 5700 and 5760
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/5700 INTRODUCTION TransIT-PRO Transfection Kit was specifically developed for mammalian protein production in suspension
More informationAmaxa Basic Neuron SCN Nucleofector Kit
Amaxa Basic Neuron SCN Nucleofector Kit For Primary Neural Cells (Small Cell Number) SCN Nucleofector Kits are compatible with Nucleofector ll Devices of serial version S with software version S4 4 or
More informationAmaxa Chicken Neuron Nucleofector Kit
Amaxa Chicken Neuron Nucleofector Kit For Primary Chicken Hippocampal Neurons Primary dissociated chicken hippocampal neurons, prepared from chicken embryos (E7) as mixed glial cultures. Example for Nucleofection
More informationHYPE-293 Transfection Kit Results
HYPE-293 Transfection Kit Results Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 ()26 326 44 5 T BE +32 ()2 53 3 48 Begonialaan 3a F NL +31 ()26 326 44
More informationCHOgro Expression System
CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with robust
More informationTransIT-PRO Transfection Reagent Protocol for MIR 5740 and 5750
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/5740 INTRODUCTION TransIT-PRO Transfection Reagent was developed by empirically testing proprietary lipid and polymer
More informationTransIT-PRO Transfection Kit Protocol for MIR 5700 and 5760
INTRODUCTION TransIT-PRO Transfection Kit consists of a DNA transfection reagent and boost combination specifically developed for mammalian protein production in suspension 293 and CHO derived cells. The
More informationAmaxa Basic Neuron SCN Nucleofector Kit
Amaxa Basic Neuron SCN Nucleofector Kit For Primary Mouse Hippocampal Neurons (Small-Cell-Number) Embryonic mouse hippocampal neurons transfected using the Nucleofector Technology A B Approximately 100.000
More informationIngenio Electroporation Kits and Solution
Protocol for MIR 08, 09, 01, 0111, 0112, 0113, 0114, 011, 0116, 0117, 0118, 0119 Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/0111 INTRODUCTION Ingenio Electroporation
More informationAmaxa 4D-Nucleofector Basic Protocol for Human Stem Cells For 4D-Nucleofector X Unit Transfection in suspension
For 4D-Nucleofector X Unit Transfection in suspension Pluripotent cells, adherent This basic protocol describes how to easily define optimal Nucleofection Conditions for different human stem cells (e.g.
More informationNucleofector Technology in. Somatic Stem Cell Research. gene transfer begins here
Nucleofector Technology in Somatic Stem Cell Research The Nucleofector technology The first highly efficient method for non-viral gene transfer into primary cells and difficult-to-transfect cell lines
More informationTransient production of recombinant proteins using the MEXi system
Transient production of recombinant proteins using the MEXi system Dennis Niermeier IBA GmbH Dennis Niermeier 216 Small amounts (mg range) of protein are required in a short time for many experiments and
More informationCHOgro Expression System
SDS and Certificate of Analysis available at mirusbio.com/6260 INTRODUCTION The CHOgro Expression System is an optimized platform for transient, high titer protein production in suspension CHO derived
More information4D-Nucleofector What is nucleofection?
4D-Nucleofector What is nucleofection? The Amaxa Nucleofector Technology + Cell of interest Gene of interest slide 2 The Amaxa Nucleofector Technology Cell type specific + Solution Gene transfer into cytoplasm+nucleus
More informationFectoPRO DNA transfection kit for Bioproduction PROTOCOL
DNA transfection kit for Bioproduction PROTOCOL DESCRIPTION transfection kit is specifically designed for enhanced Transient Gene Expression using low DNA amounts, in suspension CHO and HEK-293 cells as
More informationAmaxa 4D-Nucleofector Protocol for Undifferentiated Human Mesenchymal Stem Cells [MSC] For 4D-Nucleofector X Unit Transfection in suspension
Amaxa 4D-Nucleofector Protocol For 4D-Nucleofector X Unit Transfection in suspension Self-isolated or Poietics Human Mesenchymal Stem Cells from bone marrow [Lonza, Cat. No. PT- 2501] Example for Nucleofection
More informationamaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3
Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment
More informationjetprime in vitro DNA & sirna transfection reagent PROTOCOL
jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful transfection reagent based on a polymer formulation manufactured at Polyplus-transfection. jetprime
More informationIngenio Electroporation Kits and Solution
Protocol for MIR 0111, 0112, 0113, 0114, 011, 0116, 0117, 0118, 0119 INTRODUCTION Ingenio Electroporation Kits and Solution provide a universal, high efficiency, low toxicity solution for electroporation
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 is a broad spectrum transfection reagent that provides superior transfection of plasmid DNA into mammalian cells. TransIT-2020 is suitable for both transient and stable transfection
More informationAmaxa 96-well Shuttle Optimization Protocol for Cell Lines
maxa 96-well Shuttle Optimization Protocol for Cell Lines For Use with Plasmid DN and/or sirn The Cell Line Optimization 96-well Nucleofector Kit (V4SC-9096) enables you to optimize 96-well Nucleofection
More informationTransIT -LT1 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationFectoCHO Expression system DNA transfection kit for protein production PROTOCOL
FectoCHO Expression system DNA transfection kit for protein production DESCRIPTION PROTOCOL FectoCHO Expression system is a three-component kit that includes FectoPRO transfection reagent, FectoPRO Booster
More informationTransIT -293 Transfection Reagent
TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide
More informationIntroduction to Sinofection
Introduction to Sinofection Sinofection is a superior cationic polymer-based transfection reagent. It has been successfully applied to transfection at various scales over a broad range of cell lines. Compared
More informationTHE DELIVERY EXPERTS PROTOCOL
THE DELIVERY EXPERTS jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful molecule based on a polymer formulation manufactured at Polyplustransfection. jetprime
More informationAmaxa Automated Nucleofection on Tecan Freedom EVO Workstation
Amaxa Automated Nucleofection on Tecan Freedom EVO Workstation Combining Leading Technologies to New Solutions for Drug Discovery Fully automated high throughput transfection with Tecan and Lonza s combined
More informationNucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System)
Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) BACKGROUND This protocol describes how to transfect
More informationTransIT -293 Transfection Reagent
INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in HEK 293 and cell types of associated lineage. TransIT-293 provides
More informationWELCOME TO THE FUTURE OF TRANSIENT EXPRESSION. Smart start guide for the ExpiCHO system
WELCOME TO THE FUTURE OF TRANSIENT EXPRESSION Smart start guide for the ExpiCHO system 2 Contents Smart start tips 6 Shake grid 7 Frequently asked questions (FAQs) Getting started 8 Cell handling 8 Medium
More informationjetprime DNA & sirna transfection reagent
jetprime in vitro DNA & sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Transient DNA transfection protocol... 4 1.1 Cell seeding... 4 1.2 DNA Transfection Protocol...
More informationTransIT -LT1 Transfection Reagent
INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid DNA delivery in many mammalian cell types including primary cells. TransIT-LT1 is a low
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells. TransIT-2020
More informationAmaxa 4D-Nucleofector Protocol for Primary Mammalian Neurons For 4D-Nucleofector X Unit Transfection in suspension
For 4D-Nucleofector X Unit Transfection in suspension Primary mammalian neurons, primary neurons freshly isolated embryonic (E18) or neonatal (P1 2) mammalian neural tissues. Mammalian neurons display
More informationTransfection Reagent Protocol for MIR 2110, 2114, 2115, 2116
TransIT-siQUEST Transfection Reagent INTRODUCTION TransIT-siQUEST is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery and knockdown of target gene expression in many
More informationAmaxa 4D-Nucleofector Protocol for Rat Hippocampal or Cortical Neurons For 4D-Nucleofector X Unit Transfection in suspension
For 4D-Nucleofector X Unit Transfection in suspension Isolated from embryonic (E17-18) or neonatal rats (P0-2) and cultured as mixed glial cells Example for of rat cortical neurons Freshly isolated rat
More informationsitran TM sirna Transfection Application Guide
sitran TM sirna Transfection Application Guide Package Contents... 1 Storage conditions... 1 Related OriGene Products... 1 Notice to purchaser... 1 Introduction... 2 Experimental Procedures... 3 Transfection
More informationTRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationTransfection Reagent INTRODUCTION SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied
TransIT-Neural Transfection Reagent INTRODUCTION TransIT-Neural Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in various neural cell types.
More informationsirna Transfection Reagent
Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).
More informationArrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743
Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Technical support: 1-888-412-2225 Page 1 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743
More informationApplication Note. Superior protein yields in suspension CHO cells using FectoPRO -mediated transient transfection in CELLSTAR CELLreactor
Application Note Superior protein yields in suspension CHO cells using FectoPRO -mediated transient transfection in CELLSTAR CELLreactor 1. Introduction The introduction of nucleic acids into cells represents
More informationBalanCD HEK293 SYSTEM
BalanCD HEK293 SYSTEM Maximize productivity in suspension cultures Versatile formulation supports transfection and production including: - Rapid, scalable production of viral vectors - Use the same system
More informationTransIT -CHO Transfection Kit
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2170 INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency
More informationingenio electroporation kits & solution
ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic
More informationTransIT -Insect Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/6100 INTRODUCTION TransIT -Insect Transfection Reagent is a novel transfection formulation specifically developed for
More informationTransIT -CHO Transfection Kit
INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in CHO cells and cell types of associated lineage. TransIT-CHO Transfection
More informationTransIT -CHO Transfection Kit
INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in CHO cells and cell types of associated lineage. TransIT-CHO Transfection
More informationDevelopment and Optimization of CHOgro Transient Expression Technologies for High Titer Antibody Production in Suspension CHO Cells
Development and Optimization of CHOgro Transient Expression Technologies for High Titer Antibody Production in Suspension CHO Cells Laura Juckem, PhD Mirus Bio LLC Providing gene delivery expertise since
More informationLullaby sirna Transfection Reagent - Results
sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for
More informationBalanCD HEK293 SYSTEM
BalanCD HEK293 SYSTEM Maximize productivity in suspension cultures Versatile formulation supports transfection and production including: - Rapid, scalable production of viral vectors - Use the same system
More informationCH_07_4C_QIAGEN_PG_2007.qxd :50 Uhr Seite 238 7Transfection QIAGEN Product Guide 2007
7Transfection 238 www.qiagen.com QIAGEN Product Guide 2007 Transfection 7 Transfection www.qiagen.com/pg/transfectiontools 7.0 Transfection selection guide 240 7.1 sirna/mrna transfection Transfection
More informationMulti-Purpose Transfection Reagents
Product Information & Instruction Manual Multi-Purpose Transfection Reagents Cat. No: ScreenFect A S-3001 S-3001-2 S-3001-3 ScreenFect A-plus S-6001 S-6001-2 S-6001-3 www.incella.com Contents 1. Characteristics
More informationContents Introduction 2. Storage and Stability.. 2. Kit Contents Important Notes sirna Transfection Protocols 3
Contents Contents... 1 Introduction 2 Storage and Stability.. 2 Kit Contents... 2 Important Notes... 2 sirna Transfection Protocols 3 Optimizing sirna Transfection..... 3 Plasmid DNA Transfection.... 4
More informationAmaxa Nucleofector Technology. Do you have cells that are difficult-to-transfect?
Do you have cells that are difficult-to-transfect? Contents Amaxa Nucleofector Technology Introduction 3 4 Amaxa Nucleofector Technology The Components 5 4D-Nucleofector System The Advanced Platform 6
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More informationTransIT -Jurkat Transfection Reagent
INTRODUCTION TransIT -Jurkat Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in Jurkat cells and cell types of associated lineage. Jurkat cells
More informationTransIT-TKO Transfection Reagent
INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery and knockdown of target gene expression in many cell types including primary cells. TransIT-TKO
More informationTransfection Reagent SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied
TransIT-siQUEST Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2110 INTRODUCTION TransIT-siQUEST is a broad spectrum sirna transfection reagent
More informationTransIT -Insect Transfection Reagent
INTRODUCTION TransIT -Insect Transfection Reagent is a novel transfection formulation specifically developed for high-performance transfection of plasmid DNA into insect cells such as: Sf9, High Five (BTI-TN-5B1-4),
More informationGeneTrans II Transfection Reagent
MoBiTec GmbH 2012 Page 1 GeneTrans II Transfection Reagent MoBiTec GmbH 2012 Page 2 Contents Introduction... 3 Protocols... 4 DNA Diluent Selection... 4 GeneTrans Lipid Hydration... 4 Protocol for using
More informationTransIT-X2 Dynamic Delivery System
INTRODUCTION TransIT-X2 Dynamic Delivery System is an advanced, non-liposomal polymeric system that enables high efficiency transfection of many cell types, including primary cells. TransIT-X2 can be used
More informationTransIT -Prostate Transfection Kit
INTRODUCTION TransIT -Prostate Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in Prostate cell types. Generally, prostate cell types have been
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationLabBOOK VIROMER CRISPR. for RNP delivery
LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes
More informationTransIT -Keratinocyte Transfection Reagent
TransIT -Keratinocyte Transfection Reagent INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in keratinocyte
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationTransfection Kit Protocol for MIR 2900, 2904, 2905, 2906
TransIT-HeLaMONSTER Transfection Kit INTRODUCTION TransIT-HeLaMONSTER Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in HeLa cells and cell types
More informationTransIT -Jurkat Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2120 INTRODUCTION TransIT -Jurkat Transfection Reagent is specifically optimized to provide exceptional transfection
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationCalPhos Mammalian Transfection Kit User Manual
CalPhos Mammalian Transfection Kit User Manual Cat. No. 631312 PT3025-1 (PR3Z643) Published 22 December 2003 Table of Contents I. Introduction 3 II. List of Components 4 III. Additional Materials Required
More informationIn vitro Transfection Protocol
BIOMOL GmbH Waidmannstr. 35 22769 Hamburg info@biomol.de www.biomol.de Phone:+49-40-8532600 or 0800-2466651 (D) Fax: +49-40-85326022 or 0800-2466652 (D) In vitro Transfection Protocol Technical Assistance...
More informationGibco ExpiCHO Expression System
Gibco ExpiCHO Expression System Essential protocol guide The ExpiCHO system is so easy; it takes less work than making proteins in E. coli. The scalability of the system is fantastic; I can express 30
More informationThis product is exclusively for research and for in-vitro application. It should not be used for therapeutic and diagnostic applications in humans.
AppliFect LowTox Transfection reagent for mammalian cells Product code A9027 Description AppliFect LowTox is a further development of existing reagents for liposome-mediated transfection of mammalian cells.
More informationTransIT -Keratinocyte Transfection Reagent
TransIT -Keratinocyte Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2800 INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically
More informationTransIT -mrna Transfection Kit
INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationData Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654
Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such
More information3D-FectIN transfection reagent - Results
3D-FectIN transfection reagent - Results OZ Biosciences is delighted to announce the launching of a new 3D transfection reagent, 3D-FectIN. 3D- FectIN is the newest reagent specifically designed and developed
More informationGeneCellin TM Transfection Reagent Protocol
GeneCellin TM Transfection Reagent Protocol Table of content Description......3 Content......3 Storage......3 Certificate of quality......4 Parameters influencing transfection efficiency......4 Nucleic
More informationPlease read the entire protocol carefully and proceed with the section(s) appropriate for the desired experiment.
Page 1 of 9 Lit.# ML044 Rev.5/18/05 TransIT -sipak Trial Kit Product Components Quantity Product No. TransIT -sipak Trial Kit TransIT -siquest Reagent* TransIT-TKO Reagent* *To re-order components separately,
More informationPart Number: GY-SMPE010. Smart PEI. Instructions for Use. For research use only. Not for use in humans.
Transfection Part Number: GY-SMPE010 Reagent Instructions for Use For research use only. Not for use in humans. Transfection Reagent 1. Intended Use SmartPEI reagent is a low toxicity, serum-compatible
More informationAlt-R CRISPR-Cpf1 System:
user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only
More informationTransfection of Jurkat cells with METAFECTENE
Transfection of cells with METAFECTENE Qian Chen and Massimo Gadina Department of Microbiology and Immunology, Queen s University, Belfast, Northern Ireland Transfection of eukaryotic cells is widely used
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationProduct Quantity* Product No.
Page 1 of 6 Lit.# ML015 Rev.7/04 TransIT-TKO Transfection Reagent Product Quantity* Product No. TransIT-TKO Transfection Reagent 0.4 ml MIR 2154 1 ml MIR 2150 5 ml (5 x 1 ml) MIR 2155 10 ml (10 x 1 ml)
More information