Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman
|
|
- Marilynn Caldwell
- 6 years ago
- Views:
Transcription
1 Cell Metabolism, Volume 7 Supplemental Data Short Article Transcriptional Regulation of Adipogenesis by KLF4 Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman Supplemental Experimental Procedures Plasmids For overexpression studies, KLF4 cdna was cloned by RT-PCR and an HA epitope was added at the C terminus. It was subsequently inserted into pmscvpuro(clontech). Other pmscv vectors are as used in Chen et al. (6) FLAG-KLF4 is courtesy of Douglas Boyd. For knockdown of KLF4, Krox20 or C/EBPβ expression in 3T3-L1 cells, the DNA-based, retroviral vector-mediated sirna technology was used. The targeted sequence was determined by the Whitehead Institute sirna designing tool and verified by BLAST searches to ensure specificity. Two complementary oligos for each targeted sequence were then designed according to the protocol of Clontech s RNAi-Ready psiren-retroq system, annealed, and ligated into the BamHI/EcoRI-linearized psiren-retroq vector. The resulting plasmid, upon packaged into retrovirus, allowed stable expression of sirna hairpin for a specific gene. All sequences for the sirna constructs were as described in Chen et al. (2005). KLF4 knockdown sequences were: zc-si-gklf-2.1 F TACACACGTAAAGATCACCGATCCGTACACACGTAAAGATCACCTTGCTAGCAGGT GATCTTTACGTGTGTACTTTTTTG zc-si-gklf-2.1 R AATTCAAAAAAGTACACACGTAAAGATCACCTGCTAGCAAGGTGATCTTTACGTGTG TACG zc-si-gklf-3.2 F AGATCACCTTATATGCTCTGATCCGAGATCACCTTATATGCTCTTTGCTAGCAAGAG CATATAAGGTGATCTCTTTTTTG zc-si-gklf-3.2 R AATTCAAAAAAGAGATCACCTTATATGCTCTTGCTAGCAAAGAGCATATAAGGTGAT CTCG Retroviral Infections and 3T3-L1 Differentiations Recombinant pmscv or psiren-retroq viral packaging was achieved by transfection of the plasmid into Phoenix ecotropic packaging cells (cultured in DMEM with 10% FBS in 5% CO 2 ) using Fugene6 (Roche). Viral supernatants were supplemented with 8 µg/ml polybrene and
2 added to cells for infections for hr. Cells were selected with 2µg/ml puromycin or 100 µg/ml hygromycin (Sigma), expanded, and seeded for differentiation experiments. 3T3-L1 cells (ATCC) were maintained in DMEM with 10% FBS (Invitrogen) in 5% CO 2. Stable cell lines from retroviral transduction were cultured to confluence and exposed to the differentiation cocktail (1 µg/ml insulin, 0.25 µg/ml dexamethasone, 0.5 mm IBMX). After 48 hr, cells were maintained in medium containing 1 µg/ml insulin until day 8 for harvest. Plates were oil-red O stained as described earlier (Soukas et al., 2001). In experiments, where each component is added separately or in groups, the concentrations are as in the standard hormone cocktail. Coimmunoprecipitation 293T cells grown in DMEM supplemented with 10% FBS were transiently transfected using Fugene6 (Roche) according to the manufacturer s recommendations. Transfected cells were harvested in BA300 buffer (BA0 with 300mM NaCl) after 36h, and lysates were used for coimmunoprecipitation as described (Dou et al., 2005). Briefly, lysate expressing indicated plasmids were immunoprecipitated by M2 agarose beads (Sigma) and washed extensively for 3 times. Beads were denatured with SDS-PAGE loading dye, and supernatants were separated on 12% SDS-PAGE gels and western blotting was performed by anti-ha (Sigma-H6908). RT-PCR Analysis Total RNA was isolated from cells by QIAGEN RNA prep kit following TRIZOL reagent (Invitrogen). Real Time PCR was performed by the TaqMan system (Applied Biosystems) according to the manufacturer s instructions. Oligos were designed by the PrimerExpress software. Amount of expression was normalized to cyclophilin for cell culture experiments and to ELK3 for preadipocyte fraction experiments. Sequences of the TaqMan primers and probes were as described in Chen et al. (2005). Transfection and Reporter Assays The C/EBPβ reporter was kindly provided by D. Lane. Deletions were made by PCR and cloned into the pgl3 plasmid. Deletion primers were used as in Chen et al. (2005): 2.5 kb CTACGCGATGGGTCGGGGGTCAGC 2 kb CTACGCGCTAGGAGTGGCAGAAGG 1.5 kb CTACGCGCACCGGAGAGAGGCTGG 1.1 kb CTACGCGCCTCCCCAGCTTGCAGG 0.8 kb CTACGCGCCCACCGCAATCACCTG 0.5 kb CTACGCGTCTCGGGGGTCCGTTTG 0.3 kb CTACGCGGGAGGGAACTCAGAAGC
3 The reporter plasmids along with effector plasmids were transfected using Fugene6 into 293T cells at 80-90% confluence. The prl-tk (Promega) that carries renilla luciferase was also cotransfected as an internal control for transfection efficiency. Cells were harvested after 20-24h and luciferase activities analyzed using the Promega Dual-Luciferase assay kit as recommended by the manufacturer. GST Pull-down KLF4 was cloned by PCR from pmscvpuro-klf4 and subsequently inserted into pgex-t1 plasmid to express GST-KLF4 protein. GST-KLF4 protein is isolated as described (Morlon and Sassone-Corsi, 2003). In vitro transcription and translation of the Krox20 protein was performed by using the TNT T7 quick-coupled transcription-translation kit (Promega). The GST pull-down assays were performed by incubating GST fusion proteins immobilized on GST beads with invitro-translated 35 S-labeled Krox20 or Luciferase. After washing, bound proteins were isolated by eluting the proteins with 2 SDS buffer, separating them on SDS/PAGE, and developing by autoradiography. CHIP Assays ChIP assay Kit (Upstate Biotechnology, Lake Placid, NY) was used according to the method recommended by the manufacturer, with minor modifications. In brief, a plate of cells was fixed in the presence of1%formaldehyde for 10 min at room temperature. The reaction was stopped by the addition of glycine at a final concentration M. A soluble chromatin fraction containing fragmented DNA of 500 2,000 bp was obtained after cell lysis and sonication. The fraction was diluted ten times and precleared by using Protein A agarose slurry. Samples were incubated with Rabbit anti-klf4 (Santa Cruz) or rabbit-igg as a control, later immunoprecipitated, and DNA was used for PCR. The primers used were as follows: CEBP kb promoter primers 5'-TCT TGG GGG CGG AGG TCA C-3' 5'-GGG GGC AGG GAG GGA AAG GGT AAG-3' CEBP 2.5 kb promoter control primers 5'-GCA ACT TGT CAA CAC CCT GTC TCA-3' 5'-GCT TCC TGT CCC AAC CTC ATG TTT-3' SDS-PAGE and Immunoblotting Proteins were separated by SDS-PAGE using pre-cast 4-20% or 12% SDS gels (Bio-Rad) and transferred to nitrocellulose membranes. Western blot has been performed as described (Boyer- Guittaut et al., 2005). Briefly, total protein lysate (20 50 µg) was loaded on SDS-PAGE for each sample. Rabbit anti-klf4, rabbit anti-c/ebpβ, and mouse anti-tbp were from Santa Cruz (H- 180, C-19, and N-12, respectively). HRP-conjugated anti-rabbit and anti-mouse secondary antibodies were from Amersham (GE). Mammalian Two-Hybrid Assays CheckMate Mammalian Two-Hybrid System (Promega) was used for mammalian two-hybrid experiments. The pgal4-krox20 and pvp16-klf4 fusion constructs were made and transfected along with pg5luc Vector into 293T cells as described in manufacturer s manual.
4 Gel Shift Assays EMSA was performed by incubating 5 ug of Nuclear extracts or 100ng of purified protein at room temperature for 20 min in a 30-µl binding reaction mixture containing 10 mm HEPES, ph 7.9, 80 mm KCl, 5% glycerol, 30 ng of poly(di-dc), 75 ng of denatured salmon sperm DNA, 10 mm dithiothreitol, and 30,000 cpm of 32 P-labeled double-stranded DNA probe. Following incubation, reaction mixtures were loaded on a 5-7% polyacrylamide gel, dried, and subjected to autoradiography. A 500-fold molar excess of unlabeled probe was added for competition as indicated in the appropriate figures. For competition experiments, proteins were preincubated for 20 minutes at room temperature with unlabeled probe at specified -fold excess. Labeled probe was then added and incubated for 20 min at room temperature. Gel shift assay oligo sequences were as below: G1 5'-GTG CAT GGC GAC CTA CAG GCA GGG AAG AAT AGT CAC CAG TGT TGG AG-3' 5'-CTT CTC CAA CAC TGG TGA CTA TTC TTC CCT GCC TGT AGG TCG CCA TG-3' G2 5'-GAG AAG GGA GGG CCC GTT AGT GAA GCC CCA ACG TCC CAC TTT ACA GC-3' 5'-CTG GCT GTA AAG TGG GAC GTT GGG GCT TCA CTA ACG GGC CCT CCC TT-3' G3 5'-AGC CAG GCC TGG CTG GGT GGC CCT GGG GAT GTC ACC ACG CCT CTC TG-3' 5'-GCC CAG AGA GGC GTG GTG ACA TCC CCA GGG CCA CCC AGC CAG GCC TG-3' G4 5'-CTG GGC CCT GAT CCC TTC CTG GCC CAG AGG CTG CTG GGA AGG CCA GA-3' 5'-CTT TCT GGC CTT CCC AGC AGC CTC TGG GCC AGG AAG GGA TCA GGG CC-3' G5 5'-AGA AAG CCG CAG GCA GGC AGG GCT AGC GTC TTA CCC TTT CCC TCC CT-3' 5'-GGC AGG GAG GGA AAG GGT AAG ACG CTA GCC CTG CCT GCC TGC GGC TT-3' G6 5'-CCT GCC CCC CAC CCC CAA GGG CAC AGG GAG ATG TCA TTT CTC CAG CT-3' 5'-AAG AGC TGG AGA AAT GAC ATC TCC CTG TGC CCT TGG GGG TGG GGG GC-3' G7 5'-AGC TCT TGG GGG CGG AGG TCA CCC CAG CTC AGC AGA TAA CAC CGA AG-3' 5'-AAC CTT CGG TGT TAT CTG CTG AGC TGG GGT GAC CTC CGC CCC CAA GA-3'
5 Figure S1. Expression Profiles of C/EBPβ and Krox20 mrna Levels during 3T3-L1 Differentiation Figure S2. Dose-Dependent Effect of KLF4 Transfection on C/EBPβ Transcription 293T cells were transfected with increasing concentrations of KLF4 plasmid along with luciferase reporter construct (B3K), carrying 3kb promoter region of C/EBPβ (generously provided by D. Lane) and prl-tk (renilla). Each value represents the mean (SEM) of three replicates from a single experiment. Results are expressed as firefly luciferase activity normalized to renilla luciferase activity.
6 Figure S3. (A) Gel shift assay with 293T nuclear extracts overexpressing KLF4 (upper panel) or purified GST-KLF4 (lower panel). Seven 55bp oligos spanning the 1.45kb-1.1kb region were checked for their ability to bind to nuclear extracts or recombinant GST-KLF4 protein. Oligos are noted in Supplemental Experimental Procedures. (B) A deletion series between kb fragment derived from of a luciferase reporter construct (B3K) was cotransfected with 250ng of pmscv-klf4 and prl-tk (renilla). Results were expressed as firefly luciferase activity normalized to renilla luciferase activity.
7 Figure S4. Conservation in kb Promoter Region of C/EBPβ Gene (UCSC Genome Browser) Figure S5. Interaction of KLF4 with Krox20 Analyzed by the Mammalian Two-Hybrid System 293T cells transfected with pbind-krox20, pact-klf4, pg5 luc, and renilla luciferase plasmid were cultured for 36 h, and then harvested. Luciferase assays were performed. (PROMEGA)
8 Figure S6. Individual components of the induction cocktail (IBMX, dexamethasone and insulin) were added onto confluent 3T3-L1 cells alone or in combination. Cells were harvested 2h post-treatment for TaqMan analysis of KLF4, Krox20 and C/EBPβ. Upper panel: dose-dependent induction of C/EBPβ by IBMX. Confluent 3T3-L1 cells were treated by increasing amounts of IBMX (0 to 0.5 mm). Lower panel: cells were harvested 2h-post induction for TaqMan analysis.
9 Figure S7. (A) Effect of overexpressing KLF4 on adipocyte differentiation. 3T3-L1 cells were infected with pmscv-derived retroviruses carrying either pmscv-klf4/krox20 or empty vector, selected for puromycin resistance, expanded as mixed population and induced to differentiate using MDI cocktail. Figure S7A shows ORO staining of KLF4 knockdown and control hairpin cell lines at day 8. (B)Effect of overexpressing KLF4 on 3T3-L1 proliferation. KLF4 overexpressing and control cell lines were pulsed for 4 hours with BrdU. Cells were fixed by 70% ethanol and stained by anti-brdu FITC antibody (BD Biosciences).
10 Figure S8. Phosphorylation of CREB in KLF4 Knockdown Cell Lines KLF4 knockdown and control 3T3-L1 cells were induced to differentiate using MDI cocktail. Cells were harvested at the indicated time points for immunoblotting. Figure S9. p300 Is the Predominant Coactivator of KLF4 In Vitro The KLF4 and Krox20 plasmids were transfected into 293T cells along with the luciferase reporter carrying 3kb C/EBPb promoter and a series of coactivators. Results were normalized to renilla luciferase.
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationLuo et al. Supplemental Figures and Materials and Methods
Luo et al. Supplemental Figures and Materials and Methods The supplemental figures demonstrate that nuclear NFAT is situated at PODs, overexpressed PML does not increase NFAT nuclear localization, and
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationSupplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32
Molecular Cell, Volume 32 Supplemental Data Lin28 Mediates the Terminal Uridylation of let-7 Precursor MicroRNA Inha Heo, Chirlmin Joo, Jun Cho, Minju Ha, Jinju Han, and V. Narry Kim Figure S1. Endogenous
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationSupplementary Information
Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupplementary Figure 1 Tmod3 expression and phosphorylation. (a) Expression of Tmod3 in 3T3-L1 preadipocytes and differentiated adipocytes.
1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Supplementary Figure 1 Tmod3 expression and phosphorylation. (a) Expression of Tmod3 in 3T3-L1 preadipocytes and differentiated
More informationNongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers
Supporting Information For Nongenetic Reprogramming of the Ligand Specificity of Growth Factor Receptors by Bispecific DNA Aptamers Ryosuke Ueki,* Saki Atsuta, Ayaka Ueki and Shinsuke Sando* Department
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSUPPLEMENTARY INFORMATION. Material and methods
SUPPLEMENTARY INFORMATION Material and methods Cell culture Human hepatocellular carcinoma (HepG) cells and human embryonic kidney (HEK)93 cells were grown in Dulbecco s modified Eagle s medium (Invitrogen
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationChapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationAn evolutionarily conserved negative feedback mechanism in the hippo pathway reflects functional difference between LATS1 and LATS2
/, Supplementary Advance Publications Materials 2015 2016 An evolutionarily conserved negative feedback mechanism in the hippo pathway reflects functional difference between LATS1 and LATS2 Supplementary
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationSUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
More informationSupporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
More informationTotal RNA was extracted from ESCs or wild-type MEF using an RNeasy Plus mini kit
Supplementary information, Data S1 Materials and methods RNA-seq Total RNA was extracted from ESCs or wild-type MEF using an RNeasy Plus mini kit (Qiagen). Poly A+ RNA was purified from the total RNA and
More informationSupporting Information. for. Angew. Chem. Int. Ed. Z Wiley-VCH 2004
Supporting Information for Angew. Chem. Int. Ed. Z53445 Wiley-VC 2004 69451 Weinheim, Germany Small Interfering RNA Expression in Cells Based on an Efficiently Constructed Dumbbell-shaped DNA Masumi Taki,
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Coding and noncoding transcription at the vg locus. (a,b) qpcr analysis of developmental and tissue-specific vg mrna (a) and PRE/TRE (b) transcription, shown as percentage of TBP
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Antibodies: Anti-SRF (cat# Sc-335) and anti-igf1r (sc-712) (Santa Cruz Biotech), and anti- ADAM-10 (14-6211) were from e-bioscience, anti-ku70 (cat# MS-329-P) (Labvision),
More informationTable S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
More informationGlutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells
Glutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells Yue Pan, Marcus J. C. Long, Xinming Li, Junfeng Shi, Lizbeth Hedstrom,
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationSupporting Information
upporting Information hiota et al..73/pnas.159218 I Materials and Methods Yeast trains. Yeast strains used in this study are described in Table 1. TOM22FLAG, a yeast haploid strain for expression of C-terminally
More informationDynamic enhancer-gene body contacts during transcription elongation
Dynamic enhancer-gene body contacts during transcription elongation Kiwon Lee, Chris C.-S. Hsiung,, Peng Huang, Arjun Raj, *, and Gerd A. Blobel Division of Hematology, The Children s Hospital of Philadelphia,
More informationA Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
More informationHigh-throughput cloning and expression in recalcitrant bacteria
High-throughput cloning and expression in recalcitrant bacteria Eric R Geertsma & Bert Poolman Supplementary text and figures: Supplementary Figure 1 Frequency of SfiI sites yielding identical 3 extensions
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationElectronic Supplementary Information. Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA
Electronic Supplementary Information for Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA Shinsuke Sando,* Atsushi Narita, Masayoshi Hayami,
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationLewis x/cd15 expression in human myeloid cell differentiation. is regulated by sialidase activity
Lewis x/cd15 expression in human myeloid cell differentiation is regulated by sialidase activity Samah Zeineb Gadhoum 1, 2 and Robert Sackstein* 1, 2, 3, 4 From the Departments of Dermatology 1 and Medicine
More informationTable S1. Alteration of ZNF322A and FBXW7 protein expression levels in relation to clinicopathological parameters in 135 lung cancer patients.
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A and FBXW7 protein expression levels in relation to clinicopathological parameters in 135 lung cancer patients. ZNF322A Normal Overexpression expression
More informationThe B1 Protein Guides the Biosynthesis of a Lasso Peptide
The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More information